To investigate the biological effect of adenosine A2b receptor (A2bR) on the human hepatocellular carcinoma cell line HepG2, three A2bR siRNA constructs were transiently transfected into HepG2 cells. The results showed that A2bR siRNA reduced the levels of A2bR mRNA and protein. In order to further detect the function of A2bR, we established a stable hepatocellular carcinoma cell line (HepG2) expressing siRNA targeting the adenosine A2b receptor. Targeted RNAi significantly inhibited tumor cell growth
Adenosine is an intermediate product of adenine nucleotide metabolism. In many organs, adenosine is released into the extracellular space when the oxygen supply is decreased or energy consumption is increased [
In a previous study, we collected 64 samples of hepatocellular carcinoma from clinical patients and found that A2b receptors were highly expressed in tumor tissue and expressed in peritumoral tissues to a lesser extent by real-time PCR, Western blot, and immunohistochemical staining. These results indicate that the A2b receptor may contribute to hepatic tumor progression and may represent a good therapeutic target [
In recent years, RNA interference (RNAi) has been widely used to study gene expression regulation in mammalian cells and therapeutic intervention for various diseases including cancer [
Our vector is based on the pSilencer 3.1-H1 neo (
5′-GATCCCGTGCTGGTGATCTACATTAATTCAAGAGATTAATGTAGATCACCAGCATTTTTTGGAAA-3′ 5′-AGCTTTTCCAAAAAATGCTGGTGATCTACATTAATCTCTTGAATTAATGTAGATCACCAGCACGG-3′
5′-GATCCCGTCCCATTGTCTATGCTTACTTCAAGAGAGTAAGCATAGACAATGGGA TTTTTTGGAAA-3′ 5′-AGCTTTTCCAAAAAATCCCATTGTCTATGCTTACTCTCTTGAAGTAAGCATAGACAATGGGACGG-3′
5′-GATCCCGTTATCTCCAGGTATCTTCTTTCAAGAGAAGAAGATACCTGGAGATAATTTTTTGGAAA-3′ 5′-AGCTTTTCCAAAAAATTATCTCCAGGTATCTTCTTCTCTTGAAAGAAGATACCTGGAGATAACGG-3′
All oligonucleotides were synthesized by SBS Genetech, Ltd. The synthesized shRNA cassette was annealed and cloned into the pSilencer3.1-H1 neo vector according to the manufacturer’s instructions. A BLAST search with the target sequences was performed to ensure that only the adenosine A2b receptor gene was targeted. A scrambled control plasmid (pSilencer-3.1-Y) encoding a shRNA contained a sequence not present in the mouse, human, or rat genome databases. The sequence was as follows.
5′-GATCCAGTTCAACGACCAGTAGTCTTCAAGAGAGACTACTGGTCGTTGAACTTTTTTTGGAAA-3′ and 5′-AGCTTTTCCAAAAAAAGTTCAACGACCAGTAGTCTCTCTTGAAGACTACTGGTCGTTGAACTG-3′.
HepG2 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco), supplemented with 10% heat-inactivated FBS in a humidified incubator with 5% CO2 at 37°C. Cells were transfected with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions with 8
The treated cells were trypsinized and then centrifuged for 2 minutes at 12,000 rpm at 4°C. Cell pellets were washed with PBS, collected, and lysed with TRIzol reagent (Gibco). Total RNA was isolated by phenol/chloroform extraction, isopropanol precipitation, and 75% ethyl alcohol wash and dissolved in DEPC water. The reverse transcription reaction was set up according to Promega’s Reverse Transcription System protocol using primers for the A2b receptor (forward primer: 5′-TCCATCTTCAGCCTTCTGGC-3′; reverse primer: 5′-AAAGGCAAGGACCCAGAGGA-3′) and
Cell monolayers in six-well culture plates were washed twice with ice-cold PBS and lysed with 150
A total of 2 × 102 cells/well were suspended in complete medium containing 0.3% agarose (Gibco) and seeded in triplicate in six-well plates onto a bottom layer of complete medium containing 0.6% agarose. The plates were cultured for 14 days. Colonies were counted after methanol fixation and Giemsa staining.
A total of 50,000 cells were used for fluorescence-activated cell sorter analysis (FACS). Briefly, the cells were harvested, washed twice with PBS buffer, and then incubated at room temperature for 45 minutes. After two PBS washes, the cells were resuspended in PBS and filtered through Spectra Mesh filters (Spectrum). Data were analyzed by CellQuest software (Becton-Dickinson) and the ModFit/LT software. At total of 20,000 events were acquired from every sample.
HepG2 cells were passed into 96-well plates (1,000 cells/well) 24 hours after transfection. Viability and proliferation of cells were measured using MTT assays from the second until the seventh day after passage. For each group, 6 wells were measured every day. Experiments were carried out a total of three times, and the difference in average OD (490 nm) between treated groups was compared using the unpaired, two-tailed
Statistical analyses were performed with SPSS11.0 software. Significance was evaluated by Student’s
Four pairs of primers were cloned into pSilencer3.1-H1 neo (
Plasmid construction. The construction of vectors pSilencer-3.1-H1 neo-1, pSilencer-3.1-H1 neo-2, pSilencer-3.1-H1 neo-3, and pSilencer-3.1-H1 neo-Y.
To verify the silencing effect of the three siRNA vectors, we transfected the three vector pSilencer3.1-H1 neo-1, 2, 3 (mixed) and pSilencer3.1-H1 neo-Y (as control) into the HepG2 cell line. RT- PCR showed that transfection of mixed vector could decrease the A2b receptor mRNA about
mRNA expression levels of A2b receptor after transient transfection of the Mix siRNA constructions into HepG2 cell lines by RT-PCR
Western blot analysis of A2b receptor was comparable to the RT-PCR results (Figure
Protein expression levels of A2b receptor after transient transfection of the mixed siRNA constructs into HepG2 cell lines. Compared to normal controls, the pSilencer3.1-mix significantly reduced protein expression of the A2b receptor. The pSilencer3.1-Y did not affect the protein level of A2b receptor.
To assay the potential role of A2b receptor, HepG2 cells were stably transfected. MTT assays were used to investigate anchorage-dependent growth rates. Equal amounts of control vector pSilencer3.1-neo-Y were transfected into HepG2 cell lines. Untransfected cells were used as an additional control. After seven days in culture, we compared the proliferation rate of the three groups of cells. A significant difference was observed after five days in culture. The cells transfected with pSilencer3.1-neo-mix showed a significant decrease in the proliferation rate after five days in culture. However, cells transfected with pSilencer3.1-neo-Y and untransfected cells had similar proliferation rates (Figure
Inhibition of cell growth by stable transfection of pSilencer3.1-neo-mix vectors. (a) Anchorage-dependent cell growth was determined by MTT assay. HepG2 cells transfected with pSilencer3.1-neo-mix constructs inhibits proliferation. The
To determine anchorage-independent growth rates, soft agar assays were carried out. Control-transfected cells showed an average colony forming efficacy of 108 ± 10.7%, compared to untransfected HepG2 cells (= 100%). In contrast, stably transfected cells showed a decreased colony forming ability of 60.33 ± 9.6% compared with HepG2 cells (
To explore the mechanism of growth suppression in A2bR-silencing cells, cell cycle analysis was performed. The number of cells in Go/G1 phase was 89.56, 62.01, and 56.19% for the pSilencer3.1-neo-mix, pSilencer3.1-neo-Y, and untransfected cells, respectively (Figure
Cell cycle distribution showing the percentage of cells in G0/G1, S and G2/M phase according to DNA content.
Group | G0/G1 (%) | S (%) | G2/M (%) | |
---|---|---|---|---|
pSilencer3.1-neo-Mix | 3 | |||
pSilencer3.1-neo-Y | 3 | |||
Control | 3 |
Analysis of cell cycle after silencing the A2b receptor gene in HepG2 cell line. Stably transfected HepG2 cells were prepared for FACS analysis after 5 days. The pictures show one representative experiment from three total repeats.
Liver cancer is the fifth most important cancer worldwide in terms of morbidity but the third in terms of mortality. In addition, its mortality has increased in recent years, with 548,600 cases in the year 2000 [
Adenosine is an endogenous nucleoside that modulates many physiological processes. Its actions are mediated by interaction with specific cell membrane receptors. Adenosine receptors modulate intracellular levels of adenosine 3′,5′-cyclic monophosphate (cAMP). Significant advances have been made in the understanding of the molecular pharmacology and physiological relevance of adenosine receptors, but little is known about A2b receptors. A2b receptors have been implicated in mast cell activation [
RNA interference (RNAi) is a natural silencing process first described in
In this study, we constructed three RNAi vectors which target the A2b receptor gene to investigate if silencing can convert the tumor phenotype. First, the mixed plasmid constructs were transiently transfected into HepG2 cells. As shown by RT-PCR and Western blot, transfected cells showed specific silencing of the A2b receptor gene without interrupting other molecular interactions. A stably transfected HepG2 cell line which silences the expression of A2b receptors was constructed to observe any changes in phenotype. MTT and soft agar assays show that the proliferation rate of the stably transfected cells was significantly decreased compared with control-transfected or untransfected HepG2 cells. FCM experiments revealed that 89.56 ± 3.15% of stably transfected cells were in the G1 phase. Taken together, these results show that RNAi silencing of the A2b receptor gene alters the phenotype of HepG2 cells, and this method might lead to development of novel therapies for the human hepatocellular carcinoma.
The authors thank Li-feng WANG for his contribution to the design of RNAi target sequence. Their special thanks are due to Dr. R. Medzhitov for kindly providing the vectors. They also thank Dr. De-sheng Wang for the amendments of the paper. Hong-Tun Xiang and Fu-Lu Chai contributed equally to this work.