Mantle cell lymphoma (MCL) is a B-cell non-Hodgkin lymphoma (NHL) which is one of the most aggressive lymphomas. Despite recent improvements in therapies, the development of therapy-resistance is still a major problem; therefore, in order to understand the molecular basis of therapy-resistance, stable therapy-resistant MCL cell lines have been established by us. Based on the gene expression profiles of these cell lines, Polo-like kinase 1 (PLK1) was chosen as a therapeutic target. In this paper, we demonstrate a significant antilymphoma effect of targeting PLK1 in therapy-resistant MCL cells and primary MCL cells from refractory patients. PLK1 knockdown with the antisense oligonucleotide (ASO)/or small molecule inhibitor BI2536 showed significantly decreased proliferation and increased apoptosis in therapy-resistant MCL cell lines and MCL primary cells. Additionally, the direct protein-protein interaction partners of PLK1 were mapped using ingenuity pathway and confirmed the level of association of these partners with PLK1 based on their expression changes following PLK1 knockdown using real-time PCR. Results suggest that PLK1 is a viable target for the treatment of therapy-resistant MCL.
Mantle cell lymphoma (MCL) is an aggressive form of B-cell non-Hodgkin lymphoma. MCL is typically diagnosed at late stage, predominantly in elderly males and commonly metastasizes to multiple sites including the liver, kidney, gastrointestinal tract, or bone marrow [
While the median overall survival has improved to around seven years with the advancements in therapies, the recurrence due to therapy-resistance is still a major problem in refractory MCL. Combination chemotherapy regimens like CHOP combined with rituximab are common and frontline responses are generally good, but the development of therapy-resistance precludes long-term survival [
As previously described, our lab has generated therapy-resistant MCL cell lines from the relapsed lymphoma from liver (GRL), kidney (GRK), and lungs (GRR) of CHOP and bortezomib-treated NOD-SCID mice bearing Granta 519 human MCL [
Antimitotic drugs have been successful in the treatment of various types of cancer [
We hypothesized that PLK1 is involved with the development of therapy-resistance in MCL and that the knockdown of this gene will effectively kill MCL cells that are resistant to standard therapies. The main objective of this study was to show that PLK1 plays an important role in therapy-resistant MCL and that its knockdown has antilymphoma effects in
The therapy-resistant MCL cell lines were established from the relapsed lymphoma cells from liver, kidney, and lungs from Granta 519 bearing NOD-SCID mice following treatment with CHOP chemotherapy and bortezomib as described previously [
The parental MCL cell line GP was purchased from Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ, Germany). The parental GP, GRL, GRK, and GRR therapy-resistant MCL cell lines were maintained in RPMI media (Invitrogen, CA, USA) containing 10% FBS (Atlanta Biologicals, GA, USA), 100 U/mL penicillin, 100
The PLK1 expression was knocked down using antisense oligonucleotide (ASO) or small molecule inhibitor BI2536. The concentration of PLK1 ASO used in the cell treatments was 5
List of primers and sequences of antisense oligonucleotide (F: forward, R: reverse).
Name of gene | Genebank accession | Sequence |
Product size |
---|---|---|---|
PSMB5 (F) |
NM_002797 | AGGCGTGCTTGCCAGCAGTC |
91 |
PKMYT (F) |
NM_004203 | GGGATGACGACAGCCTAGGGCCTTC |
218 |
CHUK (F) |
NM_001278 | GACCGTGTGCTCAAGGAGCTGT |
209 |
CDK1 (F) |
NM_001786 | TGGCCTTGCCAGAGCTTTTGGA |
106 |
MDM2 (F) |
NM_002392 | TTTCGCAGCCAGGAGCACCG |
127 |
AURKA (F) |
NM_003600 | TCGGTTCCTCCGTCCCTGAGTGTC |
134 |
PLK1 antisense (ASO) | NM_005030 | ACCAGTCCGGAGGGGAGGGC | |
Scrambled antisense (ASO) | CAGGGCTGACAGCGAGGCGG |
Twenty thousand cells from GP and each type of therapy-resistant cell line (GRK, GRL, and GRR) were cultured in triplicate in RF-10 media containing PLK1 inhibitor BI2536 or DMSO (vehicle) in 96-well plates. Similarly, these cells were also treated with PLK1 ASO or SCR ASO along with untreated controls. The growth of these cells were determined at 48 and 72 hours using MTT and 3[H]-thymidine uptake assays. In brief, 25
Twenty thousand cells from each type of therapy-resistant cell line (GRL, GRK, and GRR) and parental GP were cultured in triplicate in RF-10 media containing PLK1 ASO or scrambled ASO (control) in 96-well plates. After 48 hours of the ASO treatment, withdrawal of PLK ASO was performed in the culture following spin down of the cells and then fresh RF-10 media was added to the cells. Following withdrawal, cells were further cultured for 48- and 96-hour time points and their viability was determined using MTT growth assay. The viability of cells was compared with PLK ASO-silenced or control ASO-treated cells.
The MCL cells were cultured at a concentration of 1 × 106 cells/mL in RF-10 media containing BI2536 or DMSO or PLK1 ASO or SCR ASO for the desired time points. Following the treatment, the percentage of cells undergoing apoptosis was determined using Annexin-V assay kit (BD Biosciences, CA, USA). Briefly, the cells were washed twice with cold PBS and resuspended in 1X binding buffer; 5
Primary MCL cells were obtained from leukemic phase MCL patients using an institutional review board approved protocol and informed consent. Mononuclear cells (MNCs) were isolated from MCL patient peripheral blood using lymphocyte separation medium (Accurate Chemical and Scientific, Westbury, NY) described previously [
GRK, GRL, GRR, and parental GP cells were cultured in RF-10 media containing BI2536 or vehicle (DMSO) treatment. Following 24 hours of incubation, total RNA from each group was extracted and purified using TRI Reagent according to the manufacturer’s instructions (Invitrogen, CA, USA). Five micrograms of total RNA was then used for reverse transcription with the superscript RT enzyme (Invitrogen, CA, USA). The resulting cDNA was subjected to SYBR green real-time PCR to investigate the differential expression of PLK1 interacting genes including AURKA, PSMB5, MDM2, PKMYT, CHUK, and CDK1. The primer sequences used for these genes are summarized in Table
Since the PLK1 is overexpressed in refractory MCL and PLK1 expression has shown to be associated with poor clinical outcome in other cancers, we targeted the PLK1 expression in therapy-resistant MCL cells. For the initial experiments we used the specific antisense oligonucleotide (ASO) to downregulate PLK1 expression. Subsequently, we have used BI2536, a small molecule inhibitor of PLK1 to inhibit expression of PLK1, in therapy-resistant MCL cells.
In order to determine the effect of downregulation of PLK1 in therapy-resistant MCL cells, proliferation and survival were measured using MTT assay, 3[H]-thymidine uptake method and annexin-V staining, respectively. Figure
We also investigated whether PLK1 reintroduction restores the chemoresistant properties in the PLK1 ASO-silenced therapy-resistant and parental GP MCL cells. For this purpose, we performed PLK1 ASO withdrawal experiment after PLK1 silencing in therapy-resistant and parental GP MCL cell lines that can restore the expression of PLK1. Our results clearly showed that following 96 hours PLK1 ASO withdrawal/depletion, the viability of these MCL cell lines was significantly increased compared to the PLK1-silenced cells, as determined by MTT growth assay (Figure
In addition to annexin-V staining to measure the apoptotic cell population, we also examined the MCL cells following downregulation of PLK1 with BI2536 using light microscopy of Giemsa stained MCL cells. As shown in Figure
Cytomorphology of therapy-resistant MCL cells following PLK1 downregulation. Parental and therapy-resistant MCL cells treated with or without BI2536 inhibitor of PLK1 were evaluated for the presence of apoptotic bodies using cytomorphology. The rows from top to bottom consist of GP, GRK, GRL, and GRR. The left column consists of control- (DMSO-) treated cells and the right column consists of cells that have had PLK1 knocked down with BI2536. These observations were examined 48 hours after treatment at 40x magnification using a light microscopy.
Once we confirmed the cytotoxic effects of targeting PLK1 in MCL cell lines, as a logical next step to determine the antilymphoma effects of BI2536 against primary refractory MCL cells, we treated the MCL cells purified from patient blood with leukemic phase of MCL. Figures
Viability, proliferation, and apoptosis of primary refractory MCL cells following PLK1 downregulation with BI2536. Viability (a) and proliferation (b) were measured at 24, 48, and 72 hours after treatment using MTT and 3[H]-thymidine uptake assays, respectively, while apoptosis (c) was measured at 48 and 72 hours using annexin-V staining. The values represent the means ± SE from triplicate wells of the 96 well plates. These results are representative from two different MCL patient samples.
PLK1 knockdown produces significant reductions in viability/proliferation and significant increases in apoptosis of clinical patient samples and therapy-resistant MCL cells isolated from different tissue sites. We next wanted to investigate the molecular changes caused by the inhibition of PLK1 expression and how they relate to genes associated with therapy-resistance. Figure
Analyses of PLK1 interactive proteins and their expression levels following PLK1 downregulation. (a) IPA analyses demonstrate a protein-protein interaction network featuring PLK1 at the center. This network shows some of the direct interactions that take place with PLK1 and which proteins act as intermediates between PLK1 and the drugs used to generate the therapy-resistant cell lines. (b) Represents a nonquantitative RT-PCR result for the expression of PLK1 in GRL MCL cells following 24 hours of treatment with BI2536. (c) Quantitative RT-PCR results showing expression of selected PLK1-associated genes from IPA analyses in therapy-resistant and parental MCL cells following downregulation with BI2536. Expression of each gene was analyzed from Ct value obtained from real-time PCR. Fold change of genes expression was calculated with respect to vehicle- (DMSO-) treated control cells and normalized to GAPDH.
In this paper, we have demonstrated that targeting mitotic kinases is a viable strategy to treat therapy-resistant MCL cells. Specifically, we have targeted the well-studied and overexpressed member PLK1 of the mitotic kinases in refractory MCL cells. We used both PLK1-specific antisense oligonucleotides and small molecule inhibitor BI2536 of PLK1 to downregulate PLK1 expression.
Similar to other malignancies, targeting PLK1 resulted in a significant decrease in the proliferation and survival of refractory MCL cells
Since our ultimate goal is to take the PLK1 inhibitors to clinical setting in treating MCL patients, we also investigated the effect of PLK1 against primary MCL cells isolated from patients with refractory MCL. These studies demonstrated that BI2536 effectively inhibited the survival and proliferation of primary MCL cells and increased the apoptotic death of these cells.
In addition to demonstrating the antilymphoma activity of BI2536 against refractory MCL, to determine the molecular consequence of downregulating PLK1, we also examined the expression of several genes that interact/associate with PLK1 using quantitative PCR method. Interestingly, PLK1 downregulation resulted in downregulation of AURKA, MDM2, CHUK, and CDK1 which are known to be positive regulators of PLK1 whereas PKMYT, which is a negative regulator of PLK1, was upregulated in PLK1 downregulated therapy-resistant MCL cells suggesting their association with PLK1 downregulation. These results indicate that the robust antitumor effects we have observed might be due to the alteration in the expression of other key molecules that regulate cell division and survival.
In summary, this paper demonstrates that BI2536 is a viable agent to treat refractory MCL. Our results with PLK1 inhibitor against therapy-resistant MCL cells and primary MCL cells, as well as other reports showing its antitumor activity against other cancer, lay the foundation for taking this inhibitor to phase I clinical trial.
A. K. Ahrens and N. K. Chaturvedi indicate equal contribution to this work as co-first authors.
This work was supported by Lymphoma Research Foundation, New York, NY, USA and partially supported from the UNMC, College of Medicine Dean’s Research Funds. The authors also thank Kathryn Hyde for her help in preparing this paper.