Testicular cancer is a relatively rare cancer that accounts for approximately 1–1.5% of male cancers, and 90–95% of these cancers are testicular germ cell tumors (TGCTs) [
Amyloid precursor protein (APP) is a type 1 transmembrane protein that is considered to play a key role in Alzheimer’s disease. It has multiple isoforms attributable to alternative splicing and is expressed in various types of human cells. APP695 predominantly exists in the neurons whereas other isoforms such as the APP751 and APP770 are expressed in nonneuronal cells [
We have previously shown that APP is a primary androgen-responsive gene that promotes the growth of prostate cancer cells [
Sixty-four testicular specimens and 21 snap-frozen testicular samples were obtained from orchiectomies performed between 1985 and 2004. These samples were used for analysis of APP immunostaining and mRNA expression.
For APP immunostaining, 64 cancerous lesions and 31 benign testicular lesions were identified in 64 slides. The 64 cancerous lesions included 41 SGCTs and 23 NGCTs. NGCT lesions consisted of 3 embryonal carcinomas, 1 teratoma, 1 yolk sac tumor, and 18 mixed germ cell tumors (no case of pure choriocarcinoma). Of the 18 mixed TGCTs, 10 TGCTs consisted of both SGCT and other components of NGCT. Staging was performed according to the TNM 2009 staging system [
The age of the patients ranged from 0 to 71 years (mean, 35.2 years). Forty-two patients had pathological stage T1, and 22 patients had T2–T4. Mean levels of lactate dehydrogenase (LDH), beta human chorionic gonadotropin (
Immunohistochemistry for APP expression was performed by the streptavidin-biotin method as previously described [
Anti-APP antibody is a rabbit polyclonal antibody produced by immunizing rabbits with a synthetic peptide corresponding to residues surrounding the Thr668 of human APP695. Antibodies used in this study detect endogeneous levels of several isoforms of
Immunostained slides were evaluated for intensity scores as described in the previous literature [
Total RNA was extracted from snap-frozen samples using ISOGEN reagent (Nippon Gene, Tokyo, Japan). First-strand cDNA was generated using PrimeScript (Takara, Kyoto, Japan). The resulting cDNA was subjected to real-time polymerase chain reaction (PCR) using an Applied Biosystems 7000 sequence detector system based on SYBR Green I fluorescence. mRNA expression was normalized for GAPDH mRNA levels. PCR protocol was as previously described [ GAPDH forward: GGTGGTCTCCTCTGACTTCAACA GAPDH reverse: GTGGTCGTTGAGGGCAATG APP forward: CACAGAGAGAACCACCAGCA APP reverse: ACATCCGCCGTAAAAGAATG.
We used the statistical software JMP Pro version 9.0.2 (2010 SAS Institute Inc.) for data analysis. The chi-square test (
Majority of the patients with benign testicular lesion (80.6%) and SGCT (87.8%) had no immunostaining for APP (Table
Immunoreactivity of APP in human testicular specimens.
APP intensity score | Number of cases (%) | ||
---|---|---|---|
Normal testicular tissue | SGCT | NGCT | |
|
|
|
|
|
|
|
|
2+ | 0 (0) | 3 (0.07) | 5 (21.7) |
3+ | 0 (0) | 1 (0.02) | 4 (17.4) |
| |||
Total | 31 | 41 | 23 |
APP: amyloid precursor protein, SGCT: seminomatous germ cell tumor, NGCT: nonseminomatous germ cell tumor. Intensity score was rated from 0 to 3+ and defined as 0: no immunostaining, 1+: weak intensity, 2+: moderate intensity, 3+: strong intensity. “0” and “1+” are defined as “negative immunoreactivity.” “2+” and “3+” are defined as “positive immunoreactivity.” Numbers in boldface indicate negative immunoreactivity while those in light face indicate positive immunoreactivity.
Immunohistochemistry of amyloid precursor protein (APP) in testicular tissue specimens. (a) Negative control showing negative immunostaining. (b) Normal testicular lesion showing weak staining (intensity score: 1). (c) Seminomatous germ cell tumor lesion showing negative immunostaining (intensity score: 0). (d) Nonseminomatous germ cell tumor lesion (embryonal cancer component) showing strong APP immunostaining (intensity score: 3).
Negative control
Normal testicular lesion
SGCT
NGCT
The rate of positive APP IR was significantly higher in NGCT lesions compared with those in SGCT and in benign testicular lesions (
Relationships between APP immunoreactivity and clinicopathological characteristics in TGCT patients (
Clinicopathological data | APP immunoreactivity | ||
---|---|---|---|
Negative ( |
Positive ( |
| |
Age (years ± SD) | 36.5 ± 10.7 | 30.0 ± 15.8 | 0.182 |
Tumor marker | |||
|
0.340 | ||
|
20 | 7 | |
|
31 | 6 | |
|
0.00870 | ||
|
14 | 9 | |
|
37 | 4 | |
|
0.844 | ||
|
29 | 7 | |
|
22 | 6 | |
IGCCC | 0.222 | ||
|
6 | 1 | |
|
2 | 3 | |
|
0 | 0 | |
Stage | |||
|
0.0978 | ||
|
36 | 6 | |
|
15 | 7 | |
|
0.444 | ||
|
43 | 9 | |
|
8 | 3 | |
|
0 | 1 | |
Venous invasion | 0.0414 | ||
|
7 | 5 | |
|
44 | 8 | |
Pathology | 0.0001 | ||
|
31 | 0 | |
|
37 | 4 | |
|
14 | 9 | |
Compared histological |
|||
|
— | — | 0.00870 |
|
— | — | 0.129 |
|
— | — | 0.0002 |
APP: amyloid precursor protein, TGCT: testicular germ cell tumor, LDH: lactate dehydrogenase,
In all, cancer-specific death occurred in 3.1% (2/64) of the whole population. There was no significant difference in cancer-specific survival (
Quantitative RT-PCR analysis was performed to evaluate the relative APP mRNA levels in SGCT (
Quantitative RT-PCR analysis of amyloid precursor protein (APP) in seminomatous germ cell tumors (SGCTs) and nonseminomatous germ cell tumors (NGCTs). The figures in box and whisker plot show the relative mRNA levels of APP quantified by normalization to GAPDH mRNA levels.
APP is ubiquitously expressed in various types of human cells. The extracellular domain of the APP has been suggested to be involved in transcellular adhesion [
The present study shows that APP is more strongly expressed in NGCTs than in SGCTs. In terms of APP IR, we found a greater rate of positive cases in NGCTs than in SGCTs (39.1% versus 9.8%). APP mRNA levels were higher in NGCTs than in SGCTs. In a study by Venkataramani et al. [
Venous invasion, a risk factor for occult metastases of TGCT [
In the present study, no significant differences were observed in cancer-specific survival between APP-positive and APP-negative cases in a TGCT. Because TGCTs are highly responsive to chemotherapy or radiation therapy, cancer-specific death occurred in only 3.1% (2/64) of the whole study population. In addition, no patient was classified in the poor-risk group in IGCCC in this study. For this reason, we may not have observed significant differences in survival. However, a trend toward an association between APP IR and a higher-risk group in IGCCC were observed. In a study involving a larger patient population, positive APP IR might show a significant association with a worse-survival or a higher-risk group in IGCCC.
The mechanism of APP expression in cancer cells is not fully understood. Growth factors such as EGF and PDGF promote APP cleavage in a Ras-dependent pathway [
The current findings show that APP levels are elevated in TGCTs, especially in NGCTs. APP elevation may indicate a more aggressive histological type of TGCTs.
Amyloid precursor protein
Testicular germ cell tumor
Quantitative reverse transcription polymerase chain reaction
Seminomatous germ cell tumor
Nonseminomatous germ cell tumor
Immunoreactivity
Alpha fetoprotein
International Germ Cell Consensus Classification
Lactate dehydrogenase
Beta human chorionic gonadotropin
Epithelial growth factor receptor.
The authors declare no conflict of interests.
This study was supported by the Cell Innovation Program and Support Project of Strategic Research Center in Private Universities from the MEXT, grants from the Japan Society for the Promotion of Science, grants-in-aid from the MHLW, and the Program for Promotion of Fundamental Studies in Health Sciences of the NIBIO. The authors thank Dr. Yusuke Sato and Tomoko Yamanaka for their technical assistance.