To understand the molecular basis of sugarcane-smut interaction, it is important to identify sugarcane genes that respond to the pathogen attack. High-throughput tag-sequencing (tag-seq) analysis by Solexa technology was performed on sugarcane infected with
Sugarcane is the most important sugar crop and accounts for more than 90 percent of total sugar production in China [
Cultivation of resistant varieties is the most effective disease-control measure [
As discussed above, the mechanism of sugarcane smut defense has been studied using various techniques. However, sugarcane is a highly heterozygous crop and there is no genomic resource for this genus, so more attention is needed to establish the molecular interactions between sugarcane and pathogen. Differentially expressed genes can be investigated using a multitude of methods, such as cDNA microarray, cDNA-AFLP, RDA, SAGE, and SSH [
The application of Solexa technology for the identification of differentially expressed genes associated with the molecular mechanism of interaction between the sugarcane-smut was therefore explored. In the present study, the Illumina Solexa sequencing technology was used to reveal the response of sugarcane to infection by
The sugarcane genotypes, Yacheng 05–179 and Liucheng 03–182, were chosen as smut-resistant and smut-susceptible plant material, respectively. These two sugarcane genotypes were provided by the Key Lab of Sugarcane Biology and Genetic Breeding, Ministry of Agriculture (Fuzhou, China). Sugarcane smut fungus (
A smut spore suspension of
Total RNA was isolated using the TRIzol reagent according to the manufacturer’s instructions (Invitrogen). Dried RNA samples were dissolved in diethylpyrocarbonate-treated H2O, and RNA quality was assessed on 1.0% denaturing agarose gels. RNA quality and quantity were verified using a NanoDrop 1000 spectrophotometer and an Agilent 2100 Bioanalyzer prior to Solexa sequencing at BGI. Total RNA samples of Yacheng 05–179 before and after pathogen inoculation at the time point of 48 h were subjected to digitized expression profiling sequencing at Beijing Genomics Institute (BGI; Shenzhen, China). Both RNA samples of Yacheng 05–179 and Liucheng 03–182 were used for Real-time quantitative PCR at time point 12, 24, 36, 48, and 72 hours.
The gene expression libraries were prepared using Illumina Gene Expression Sample Prep Kit according to the manufacturer’s instructions. Specified Experimental Process, use magnetic oligo (dT) beads adsorption to purify mRNA from 6
The expressions of three candidate genes in MAP kinase signaling pathway were determined by RT-PCR and Real-time quantitative PCR (qRT-PCR). Gene-specific primers were designed according to the gene sequences using the Primer Premier 5.0 software and were synthesized commercially (Shanghai Sangon, China).
The first-strand cDNA was synthesized from total RNA using PrimeScript 1st strand cDNA synthesis kit (Takara). The primers for RT-PCR confirmation are listed in Table
Primers used for RT-PCR analysis.
Genes | Forward primer (5′-3′) | Reverse primer (5′-3′) | Product size (bp) |
---|---|---|---|
|
TTTGAGTGGTCCAATCCC | CGAGTCATCCGTCAGGTC | 1,291 |
|
CCTTCTTGGGTTCTTCCTCC | ATCCCTTCTCATAGTCTCATCTAG | 1,302 |
|
AGCCAGAAGAAAGGGAGC | GTTCATCAAGGCGGAAAC | 1,091 |
The
Primers used for qRT-PCR analysis.
Genes | Forward primer (5′-3′) | Reverse primer (5′-3′) | Product size (bp) |
---|---|---|---|
|
GCAGCCAAGCGTTCATAGC | CCTATTGGTGGGTGAACAATCC | 109 |
|
ACCTATGCCAATGTCTTACGG | GATGAAGCCAGTTGTAGCACC | 168 |
|
TGAACTGCGGCTCAATCAAAG | TGCCTCACTAGCTGGACAACA | 180 |
|
TGGACCGCACAATCAAATACTACAC | CAAAGCCCGTTCCAATGTCATAC | 108 |
After filtering 3′ adapter sequence, empty reads, low-complexity reads, and low-quality reads, a total of 4,847,568 and 4,883,691 21 bp length clean tags were obtained that corresponded to 446,284 and 423,464 distinct tags for Yacheng 05–179 before and after
Categorization and abundance of clean tags.
Summary | Inoculation | Control |
---|---|---|
Clean tags | ||
Total number | 4,847,568 | 4,883,691 |
Distinct tag number | 446,284 | 423,464 |
All tag mapping to genes | ||
Total number | 2,974,532 | 2,826,151 |
Total % of clean tag | 61.36% | 57.88% |
Distinct number | 95,633 | 82,429 |
Distinct tag % of clean tag | 21.43% | 18.81% |
One tag mapping to unique genes | ||
Total number | 639,019 | 610,306 |
Distinct number | 72,812 | 64,815 |
One tag mapping to multiple genes | ||
Total number | 1,996,930 | 1,902,489 |
Distinct number | 85,308 | 75,512 |
Unknown tags | ||
Total number | 1,376,922 | 1,532,237 |
Total % of clean tag | 28.40% | 31.37% |
Distinct number | 288,186 | 283,137 |
Distinct tag % of clean tag | 64.57% | 66.86% |
Matching the tags to genes is an important step to annotate sequences and can reveal the molecular events behind the gene expression [
Heterogeneity and redundancy are two significant characteristics of mRNA expression [
Distribution of total clean tag and distinct clean tag counts.
By using blast against the reference sugarcane EST database in NCBI and putative differentially expressed genes were selected based on the following two criteria: (1) if the average fold change of gene expression before and after
Some selected differentially expressed genes identified using Solexa sequencing in sugarcane.
Gene |
|
|
FDR | Annotation |
---|---|---|---|---|
gi |
10.6 |
|
|
|
gi |
9.2 |
|
|
|
gi |
9.0 |
|
|
|
gi |
8.8 |
|
|
|
gi |
8.8 |
|
|
|
gi |
8.8 |
|
|
|
gi |
8.6 |
|
|
|
gi |
8.6 |
|
|
|
gi |
8.5 |
|
|
|
gi |
8.5 |
|
|
|
gi |
8.4 |
|
0.000113 |
|
gi |
8.4 |
|
0.000113 |
|
gi |
8.4 |
|
0.000113 |
|
gi |
8.3 |
|
0.000214 |
|
gi |
8.3 |
|
0.000214 |
|
gi |
8.3 |
|
0.000214 |
|
gi |
8.3 |
|
0.000214 |
|
gi |
8.3 |
|
0.000214 |
|
gi |
8.2 |
|
0.000401 |
|
gi |
8.2 |
|
0.000401 |
|
gi |
8.2 |
|
0.000402 |
|
gi |
8.1 |
|
0.000741 | No match |
gi |
8.1 |
|
0.000741 |
|
gi |
8.1 |
|
0.000741 |
|
gi |
8.1 |
|
0.000741 |
|
gi |
8.1 |
|
0.000741 |
|
gi |
8.1 |
|
0.000741 |
|
gi |
8.1 |
|
0.000739 |
|
gi |
8.1 |
|
0.000739 | No match |
gi |
8.1 |
|
0.000739 |
|
gi |
5.8 |
|
0.000243 |
|
gi |
1.7 |
|
|
NSP-interacting kinase 1 |
gi |
3.3 |
|
|
MKK6-putative MAPKK mRNA |
gi |
2.2 |
|
|
No match |
gi |
|
0 | 0 | Kladothrips maslini 16S ribosomal RNA |
gi |
|
|
|
Manduca sexta actin mRNA, complete cds |
gi |
|
|
|
No match |
gi |
|
|
|
|
gi |
|
|
|
|
gi |
|
|
|
|
gi |
|
|
|
|
gi |
|
|
0.000240497 |
|
gi |
|
|
0.000819694 |
|
gi |
|
|
|
|
gi |
|
|
|
No match |
gi |
|
|
|
No match |
gi |
|
|
|
|
gi |
|
|
|
|
gi |
|
|
|
|
gi |
|
|
|
|
gi |
|
|
|
U-box domain-containing protein 21 |
Gene ontology (GO) analysis was performed by mapping each differentially expressed gene on to the reference sugarcane EST database in NCBI (
Gene ontology analysis for differentially expressed genes obtained using Solexa sequencing.
Pathway classifications for upregulated and downregulated genes.
MAP kinase signaling pathway of sugarcane infected by
Three differentially expressed genes screened in Solexa sequencing were confirmed by RT-PCR. Full-length cDNA sequence of three upregulated genes in MAP kinase signaling pathway designated as
RT-PCR products for amplification of three upregulated genes in MAP kinase signaling pathway. (a) M, DL2000; Lane 1, PCR product of
qRT-PCR analysis was applied to validate the expressions of
qRT-PCR expression profiles for
The transcriptome, which can vary with external environmental conditions, is the set of all RNA molecules, including mRNA, rRNA, tRNA, and noncoding RNAs produced in one or a population of cells [
Solexa sequencing is a high-throughput, short-read, massively parallel sequencing platform, of which the read length is relatively short (21 bp), and bioinformatics analysis of the corresponding differentially expressed genes has to only rely on sugarcane EST databases. Therefore, in the absence of corresponding sequenced genome information as a reference, many of the differentially expressed genes cannot be functionally annotated. However, the genomes of sorghum, maize and rice can act as reference information. According to sugarcane UniGenes identified and annotated by RNA-Seq and sorghum, maize and rice reference genome, we hope to establish a platform for future genetic and functional genomic research in sugarcane. In the present study, a total of 4,847,568 and 4,883,691 21 bp length clean tags that corresponded to 446,284 and 423,464 distinct tags for Yacheng 05–179 before and after
Differential gene expression during sugarcane-smut interaction is likely to be induced following pathogen challenge, which leads to up or downregulation of gene expression [
The study provides the potential to develop a molecular marker for smut resistance selection if the up-regulation of expression of
Plants possess integrated signaling networks that mediate the perception and responses to biotic and abiotic stresses which govern plant growth and development. MAP kinase signaling pathway is a conserved signaling pathway common in plants. The present results permit us to hypothesize about the role of the MAP kinase pathway on the sugarcane early response against the
In conclusion, the usefulness of the Solexa sequencing in identifying genes related to sugarcane smut defense has been successfully demonstrated in this study. However, most of the molecular mechanisms of sugarcane-smut interaction are as yet unknown. More genes related to sugarcane defense and their expression profiles in response to smut infection should be analyzed further. The present study provides a Solexa sequencing platform for gene expression research on this crop and also a reference for studying the molecular mechanism in nonmodel organisms.
The authors declare that they have no conflict of interest.
This work was funded by National Natural Science Foundation of China (31101196), the earmarked fund for the Modern Agriculture Technology of China (CARS-20) and Research Funds for Distinguished Young Scientists in Fujian Agriculture and Forestry University (xjq201202). We appreciate all ideas and constructive criticism from the reviewers. We especially thank Andrew C Allan in The New Zealand Institute for Plant & Food Research Ltd, (Plant and Food Research), Mt Albert Research Centre, Private Bag 92169, Auckland, New Zealand, for his critical revision and valuable comments on this manuscript.