The chicken anemia virus (CAV), is a known member of the genus
The chicken anemia virus (CAV) is a transmissible pathogen that infects young chickens, resulting in aplastic anemia, hemorrhages in the muscle and subcutaneous tissues, thymus atrophy, and severe immune suppression [
In order to identify circulating CAV viruses in cats in Southern China, 102 fecal samples were selected from two humane shelters located in Baiyun district (
Viral DNA was extracted from 102 fecal samples using a commercial DNA extraction kit (QIAamp DNA Stool Mini Kit, QIAgen, Hilden, Germany) according to the manufacturer’s instructions. The DNA was then quantitated and stored at −20°C until PCR was performed.
The extracted DNA was screened by PCR. The primers were as sollows: JCP1: 5′CATCAACGGTGTTCAGGC3′ and JCP2: 5′CCTTGGAAGCGGATAGTCAT3′. Primers were designed by Primer Premier 5.0 to amplify 535 bp from the partial coding regions of CAV. The PCR amplification was performed in a total volume of 25 uL, including 12.5 uL of buffer I, 4 uL dNTPs, 0.5 uL of each primer, 6 uL distilled water, 1 uL DNA, and 0.5 uL LA Taq polymerase (TaKaRa, Biotechnology, Dalian, China). Amplification reactions were performed using the automated thermal cycler (Gene Amp PCR System 9700, Applied Biosystems, Foster City, CA, USA) with the following cycling profile: initial denaturation at 94°C for 4 min followed by 30 cycles of denaturation, annealing, and extension at 94°C for 30 s, 57°C for 30 s, and 72°C for 2 min, respectively, and a final extension step was carried out at 72°C for 10 min. The 535 bp reaction product was analyzed on 1% agarose gels. Negative controls were included in every three PCR reactions and one positive control was included in each set of reactions performed. The standardized PCR amplification yielded a distinct band of 535 bp in size as expected.
The DNA from the PCR-positive sample of CAV variant was further analyzed by two primers pairs to amplify the complete CAV variant genome. Primers KQ1F, 5′-CAATCACTCTATCGCTGTGT-3′ and KQ1R: 5′-TTCGTCCATCTTGACTTTCT-3′ and primers KQ2F: 5′-GGCTACTATTCCATC(A/T)CCATTCT-3′, and KQ2R: 5′-GCTCGTCTTGCCATCTTACA-3′, were designed to amplify 1778 bp and 831 bp fragments, respectively, covering the entire genome. The PCR amplification was carried out in 50 uL volume containing 25 uL buffer I, 16 uL dNTP, 0.5 uL of each primer, 13.5 uL distilled water, 1 uL of the DNA, and 0.5 uL LA Taq polymerase (TaKaRa, Biotechnology, Dalian, China). Amplification of the 831 bp region was carried out using the following PCR conditions: initial denaturation of 94°C for 4 min followed by 30 cycles of denaturation, annealing, and extension at 94°C for 30 s, 59°C for 30 s, and 72°C for 2 min, respectively, and a final extension step was carried out at 72°C for 10 min. Amplification of the 1778 bp region proceeded for 35 cycles as follows: 5 min at 94°C, 30 s at 94°C, 30 s at 58°C, 2 min 30 s at 72°C, and a final extension step was carried out at 72°C for 10 min. PCR amplification products were analyzed on 1% agarose gels stained with ethidium bromide. PCR products were purified using the Gel Band Purification Kit (Omega Bio-Tek, USA) and cloned into the pMD19-T vector (TaKaRa Bio Inc, Japan) followed by sequencing in triplicate using an ABI 3730 Sanger-based genetic analyzer (Carlsbad, CA, USA).
The complete nucleotide sequence of CAV variant and reference sequences from different hosts from various countries were available from GenBank (Table
The GenBank accession numbers of full-length CAV genomes in isolates from different host species.
Accession number | Strain name | Host | Year | Country (area) |
---|---|---|---|---|
AB046589 | AH9410 | Chicken | 2001 | Japan |
AF285882 | SMSC-1 | Chicken | 2003 | Malaysia |
AF311892 | 98D02152 | Chicken | 2010 | USA |
AF311900 | 98D06073 | Chicken | 2010 | USA |
AF390038 | 3-1 | Chicken | 2003 | Malaysia |
AF390102 | SMSC-1P60 | Chicken | 2003 | Malaysia |
AF395114 | BD-3 | Chicken | 2004 | Bangladesh |
AF475908 | — | Chicken | 2002 | China (Harbin) |
AJ297684 | Cux-1 | Chicken | 2000 | Germany (Cuxhaven) |
AY040632 | 3-1P60 | Chicken | 2003 | Malaysia |
AJ297685 | Cux-1 | Chicken | 2000 | Germany (Cuxhaven) |
AY839944 | LF4 | Chicken | 2004 | China |
AY843527 | TJBD33 | Silkies | 2005 | China |
AY846844 | TJBD40 | Chicken | 2004 | China |
AY999018 | SD24 | Chicken | 2005 | China |
CAU65414 | 704 | Chicken | 1996 | Australia |
CAU66304 | isolate 10 | Chicken | 1997 | UK |
DQ124935 | AH6 | Chicken | 2005 | China (Anhui) |
DQ124936 | AH4 | Chicken | 2005 | China (Anhui) |
DQ141670 | SH11 | Chicken | 2005 | China (Shanghai) |
DQ141671 | SH16 | Chicken | 2005 | China (Shanghai) |
DQ141672 | HN9 | Chicken | 2005 | China (Henan) |
DQ141673 | SD22 | Chicken | 2005 | China (Shandong) |
DQ217400 | SMSC-1P9WT | Chicken | 2005 | Malaysia |
DQ217401 | SMSC-1P123WT | Chicken | 2005 | Malaysia |
DQ991394 | 01-4201 | Chicken | 2007 | USA |
EF176599 | C14 | Chicken | 2007 | China |
FJ172347 | SDLY08 | Broiler chicken | 2008 | China |
HM590588 | AGV2 | Chicken | 2011 | Brazil |
JF507715 | CIAV89-69 | Chicken | 1991 | South Korea |
JQ308210 | GyV3 | Human | 2011 | USA |
JQ690762 | AGV2 | Human | 2012 | China |
JX260426 | GD-1-12 | Chicken | 2012 | China (Guangdong) |
M55918 | Cuxhaven-1 | Chicken | 2008 | Netherlands |
NC_001427 | — | Chicken | 2009 | USA |
JX310702 | GyV4 | Human and chicken | 2012 | Hong Kong |
KC414026 | CAV variant | Cat | 2012 | China (in this paper) |
Detection of potential recombinant sequences, identification of potential parental sequences, and localization of possible recombination break points were performed with the Recombination Detection Program (RDP4) v.4.1.3 [
The survey data showed that the percentage of CAV positive samples was nearly 10% (10 of 102 fecal samples).
The complete genome sequence of CAV variant was submitted to GenBank, under the accession number KC414026. The CAV variant genome was 2,295 nt long, very close to the genome size (2,316 nt) of the CAV isolated from human fecal samples (accession no. JQ690762). Comparative analyses showed that CAV variant shared the greatest sequence identity (98.1%) with the CAV isolate from Japan (AH9410) and the least identity (38%) with the GyV3 isolate from the USA. The VP1, VP2, and VP3 genes of the CAV variant showed nucleotide variations of 1–63.1%, 0.5–51.9%, and 0.5–50.5%, respectively, among the 36 relevant sequences from GenBank. Previous studies have confirmed that the VP1 protein has the highest variability with a hypervariable region located from residues 139 to 151, while the amino acids 139 and 144 play vital roles in virus growth and spread, as VP1 residues Q139 and/or Q144 are associated with a decreased rate of spread of CIA-1 isolate [
Multisequence alignment of deduced amino acids of the coding region at positions 113, 341, 357, 371 (VP1), 20, 116 (VP2), and 79 (VP3).
The above results suggested that CAV variant (accession no: KC414026) was a potential recombinant isolate between two CAV strains, namely, CAV strain AF311900 as the minor parent and CAV strain JQ690762 as the major parent (Figure
(a) and (b) Bootscan analysis of the recombinant, major parent, and the minor parent sequences. The analysis was based on a pairwise distance model with a window size of 200, step size of 50, and 1000 bootstrap replicates generated by the RDP4 program. (c) A comparison of the three CAV isolates: AF311900/chicken, JQ690762/human, and CAV variant/cat. The KC414026/CAV variant/cat was used as the query sequence. The DQ217400 was included as an outgroup. The
Map of CAV variant (accession no: KC414026) and the recombination breakpoints (beginning breakpoint at 2,100 and ending breakpoint at 158) in alignment with the CAV variant DNA nucleotide sequence.
(a) Phylogenetic analysis of 37 CAV isolates in different species based on the genomic sequence. The three analyzed sequences (AF311900, JQ690762, and CAV variant) are indicated in red. The putative mosaic was indicated with “red dot.” (b) and (c), respectively, represent the nonrecombinant region (159-2,009) and the recombinant region (2,100-158). The putative recombination is shown with a “red square” and the putative parental lineages are shown with a “blue triangle.” The DQ217400 strain was used as an outgroup. The whole sequences were analyzed by using MEGA5.1 software with neighbor-joining (NJ) phylogenetic tree methods together with the novel sequence. Each tree was produced using a consensus of 1000 bootstrap replicates.
A CAV variant was isolated from stray cat fecal samples in China, and its genome was sequenced. The variant virus was found in 10% of samples. The CAV variant was highly pathogenic and had a very high sequence similarity with CAV. Davidson et al. reported that feathers contribute to the horizontal transmission of CAV, by carrying CAV either on their surface or within their feather pulp [
All authors declare that they have no conflict of interests related to the research presented in this paper.
The authors thank Prof. Li of the Veterinary College of South China Agricultural University for helping in collecting the fecal samples from stray cats in Guangdong province. This work was supported by grants from Guangdong Momentously Scientific and Technological Project (no. 2009B020201008) and the Strategic Cooperation Project of Guangdong Province & Chinese Academy (no. 2010B090301019).