Infections caused by commensal bacteria may be fatal for the patients under immunosuppressive therapy. This results also from difficulty in identification of high risk strains. Enterococcal infections are increasingly frequent but despite many studies on virulence traits, the difference between commensal and pathogenic strains remains unclear. Prophages are newly described as important elements in competition between strains during colonization, as well as pathogenicity of the strains.
Here we evaluate a difference in presence of pp4, pp1, and pp7 prophages and ASA (aggregation substance) gene expression in enterococcal isolates from renal transplant recipients (RTx) with different etiology of the end-stage renal failure.
Prophages sequence was screened by PCR in strains of
For many years
Colonization of urinary tract by enterococci is epidemiologically associated with ASA (aggregation substance). The ASA encoded protein increases enterococcal adherence [
Here we compare the adherence potential of enterococcal strains colonizing patients with different nephropathies by screening the prophages prevalence and ASA gene expression. Biofilm formation ability of the strains was also analyzed as an expected outcome of the adherence properties of the strains.
The majority of the known virulence traits found in enterococci are involved in adherence to extracellular structures and biofilm formation, important processes in initiating colonization and infection of the host. However, little is known about the difference in virulence gene expression between strains. Additionally, previous studies of the incidence of asa1 gene in enterococcal isolates are contradictory. In our study apart from ASA gene expression measurement, we decided also to consider prevalence of enterococcal prophages pp1 and pp4, newly described elements involved in adherence of the bacterial strain. It should be also noticed that the presence of virulence factors or their association with a strain from a particular isolation source did not seem to result from clonal spread of a few enterococcal genotypes. In another study (Dicuonzo et al., 2001) the authors analyzed the PFGE patterns of
Here, the ASA gene expression, measured by FLOW-FISH, differs greatly in
ANOVA comparison of ASA gene expression in enterococcal strains isolated from patients with different renal dysfunctions: ADPKD (autosomal dominant polycystic kidney disease), GN (glomerulonephritis), other (other nephropathies), and none (healthy volunteers). (a) planktonic cultures and (b) biofilm.
F(3, 1942) = 22,275,
F(3, 1106) = 41,764,
The significant difference was observed in ADPKD isolates. These strains presented the highest level of ASA gene expression in planktonic cells and the lowest level in biofilm. Although there is no evidence that ASA encoded protein may be involved in urinary tract infections so far [
However, according to Creti et al. [
Besides the high ASA gene expression, enterococcal strains from patients with ADPKD differ from other end-stage renal diseases, taking into consideration the biofilm formation. The isolates from urine of ADPKD patients have the tendency for relatively low level biofilm formation (0,29–0,72; median OD—optical density—0,58), comparing with the ability for biofilm formation of other enterococcal strains isolated from urine of patients with other renal diseases (GN 0,33–1,07; median OD 0,72; other nephropathies 0,69–2,16; median OD 1,25) or commensal strains (0,26–2,27; median OD 0,86). Furthermore, the mass of biofilm produced by bacteria isolated from ADPKD patients’ urine is lower than that produced by faecal isolates (0,39–1,52; median OD 0,88). The lack of such differences (in biofilm OD between the urine and feces enterococcal strains) in material from patients with other than ADPKD renal diseases suggests that the intestinal and urinary tracts’ ecological niches of patients with ADPKD are more selective than in other compared groups of patients.
The presence of prophages in isolates was the third aspect analyzed in the study. Using the PCR technique, there was the prophages existence determined in
Higher incidence of prophages sequences in strains isolated from urine of patients during immunosuppression than of healthy people was observed (about 96%versus 30%). Such observation may be the evidence of high competition between strains in immunosuppression when colonization is poorly controlled by the host. This statement is also supported by more detailed analysis: unlike enterococcal isolates from healthy individuals, the prophages incidence in fecal isolates of immunocompromised patients was similar in strains isolated from urine.
Prophages’ profile was also varied depending on the cause of renal failure. In patients who experience nephritis, incidence level of pp1 and pp4 sequence (linked to adhesion) was increased (Table
The frequency of occurring prophages sequences in bacteria from different materials (feces versus urine) isolated from various groups of people (with ADPKD, glomerulonephritis (GN), other nephropathies, and healthy volunteers).
Prophages | pp4 | pp1 | pp7 | pp(−) | pp(+) |
---|---|---|---|---|---|
Material from healthy volunteers | |||||
Urine |
|
|
|
70,00% |
|
Feces | 22,22% | 22,22% | 66,67% | 22,22% | 77,78% |
Material from patients with immunosuppression | |||||
Urine |
|
|
|
3,57% |
|
Feces |
|
|
|
4,17% |
|
Causes of end-stage renal disease | |||||
ADPKD | 38,46% | 7,69% | 92,31% | 7,69% | 92,31% |
GN | 52,38% | 52,38% | 76,19% | 0,00% | 100,00% |
Others | 38,89% | 50,00% | 61,11% | 5,56% | 94,44% |
The frequency of prophages occurrence in enterococcal isolates is also differential if the tendency to develop symptomatic or asymptomatic (due to undergoing immunosuppression) bacteriuria is taken into consideration. As shown in Figure
Composition of the prophages in isolates. The significance of difference between all groups was confirmed by ANOVA analysis on
The contrast in prevalence of pp1-, pp4-, and pp7-strains from RTx patients and isolates from urine in UTI may be explained by high competition between strains in immunocompromised patients. Such statement is also supported by higher prevalence of prophages in faecal isolates. Isolates from RTx patients were also unique by presence of pp4 prophages alone and pp7 prophages. However, in all groups adherence-related strains were present.
Different etiology of end-stage renal failure is related with difference in pretransplantation treatment and risk of infection. As shown in Figure
The other features, which distinguish bacteria isolated from patients with various renal-related diseases, are the existence of different prophages in isolates from their urinary and intestinal tracts. As presented in Table
Characteristic of patients.
Number of patients | Years after transplantation | Comorbidity | Number of UTI | Cause of renal failure |
---|---|---|---|---|
19 | 1.08 ± 1.03 | 4.42 ± 1.74 | 0–7 (0: 12p.*, 1: 3p., 2: 0p., 3: 0p., 4: 1p., 5: 1p., 6: 1p., 7: 1p.) | ADPKD**: 4 patients; |
*p: patients.
**ADPKD: autosomal dominant polycystic kidney disease.
***others: diabetic and hypertensive nephropathy and tubulointerstitial and lupus nephritis, mean ± SD.
Primers used for PCR.
pp1F | GCAGTACAGATTATAAAA |
pp1R | GATCGGCAACAAGTAATGTC |
pp7F | ACAGCACCAGACCCGACAG |
pp7R | ACGACGAGGTTCCATGTGATG |
pp4F | CAGTTCGAGTCCTGTATGG |
pp4R | AGAACGGCTTTTCAGAGAAG |
To conclude, all results presented above support statement that both immunosuppressive therapy and etiology of renal-related diseases have selective potential, allowing only bacteria with particular features (ASA gene expression, biofilm formation ability, and specific prophages coexistence) to colonize intestinal and/or urinary tract. What is more, in our opinion, strains with the low ASA expression in biofilm and/or pp1(+) pp7(+) phenotype should be considered as high-risk strains. However, further in vivo analysis is necessary to confirm this conclusion.
Forty-four enterococcal strains were isolated from urine and feces of nineteen RTx patients hospitalized at the Medical University of Gdańsk. All patients initially underwent induction with monoclonal (basiliximab) or polyclonal antibodies (ATG) and were prescribed subsequently tac (tacrolimus) + MMF (mycophenolate mofetil)/MPS (mycophenolate sodium) + glucocorticosteroids or CsA (cyclosporine) + MMF/MPS + glucocorticosteroids or CsA + everolimus + glucocorticosteroids. More detailed characterization of patients is presented in Table
As a reference group, 18 enterococcal strains of
To evaluate ASA gene expression by the FLOW-FISH method, we used a linear locked nucleic acid (LNA) probe, AGCGATAAACTAGACGTCAAAC-ATGACA 5′FITC, containing nucleic acid analogs with higher affinity for DNA and RNA [
Bacterial DNA was isolated using a commercially available kit (A&A Biotechnology, Poland). The presence of pp1, pp4, and pp7 prophages sequences was detected by the PCR method, as described earlier [
PCR was performed in a 50 mL reaction mixture that consisted of template DNA, 20 pmol of each primer (Table
Biofilms of these strains were formed in flat-bottom wells (TRP, Switzerland). The amount of the biofilm was estimated by crystal violet staining (0.1%).
The authors declare that there is no conflict of interests regarding the publication of this paper.
This research was financially supported by research Grant from the Polish National Science Centre (NN401 597540). This work was partially prepared with the support of the Cellular Pathology and Functional Imaging Network of the Medical University of Gdańsk and University of Gdańsk.