DEET (
DEET (
WHO and subsequently the US Environmental Protection Agency decided that an application of DEET-containing repellents in compliance with the instruction guidelines does not pose a health risk [
Behavioral and electrophysiological studies have demonstrated DEET interactions with antennal olfactory as well as gustatory receptors in insect [
In addition, DEET inhibits insect acetylcholinesterase (AChE) [
DEET is a mobile and persistent chemical which is commonly detected in aquatic environment around the world. Presence of DEET has been studied and monitored in various aquatic environments, such as drinking water, streams, open seawater, effluents from sewage plant, groundwater
The aim of this study was to assess the subchronic influence of DEET-containing formulation on common carp (
The test was performed using two-year-old common carps (
Concentrations of DEET were prepared from formulation Expedition 100+ (Lifemarque Ltd., UK). This formulation contains 95% of
The experiment was conducted in a flow-through system, and the test solutions were changed twice a day. The concentrations of DEET did not decrease 80% of original concentrations during the experiment. The fish were fed commercial pellets at total rate of 1.5% body weight twice a day.
At the end of the experiment, individual blood samples were taken by cardiac puncture and heparinized (50 IU per mL of blood). The carps were euthanized and their body weight and length (with/without tail) were recorded. Samples of tissues, such as kidney, gills, brain, and liver (hepatopancreas), were removed and stored at −85°C until analyses.
Two biometric parameters were calculated: the condition factor (CF) and the hepatosomatic index (HSI). The condition factor of each fish was calculated as CF = (body weight (g)/standard length (cm)3) × 100. The hepatosomatic index was calculated as HSI = liver weight (g)/body weight (g) × 100.
Haematological values, red blood cells count (RBC), white blood cells count (WBC), packed cell volume (PCV), haemoglobin (Hb), mean corpuscular volume (MCV), mean corpuscular haemoglobin value (MCH), and mean corpuscular haemoglobin concentration (MCHC), were determined according to Svobodová et al. [
Samples of head kidney and spleen from 5 fish from 3 groups (control with DMSO and DEET in 1
Primers used for gene expression by immunological examination of common carp.
Gene | Forward primer (5′-3′) | Reverse primer (5′-3′) |
---|---|---|
TNF- |
GCTGTCGCTTCACGCTCAA | CCTTGGAAGTGACATTTGCTTTT |
IL-1 |
AAGGAGGCCAGTGGCTCTGT | CCTGAAGAGGAGGCTGTCA |
TGF- |
ACGCTTTATTCCCAACCAAA | GAAATCCTTGCTCTGCCTCA |
IL-10 | AAGGAGGCCAGTGGCTCTGT | CCTGAAGAAGAGGCTGTCA |
|
GCTATGTGGCTCTTGACTTCGA | CCGTCAGGCAGCTCATAGCT |
An activity of detoxifying enzyme (glutathione S-transferase GST) and indices of oxidative stress (glutathione reductase GR, glutathione peroxidase GPx, catalase CAT, and the amount of thiobarbituric acid reactive substances TBARS) were measured in different fish tissues (liver, kidney, gill, and brain). Tissue samples were weighed and homogenized using phosphate buffer (pH = 7.4). The homogenized samples were divided into two portions: the first one was for measuring of TBARS and the second one was centrifuged (11.000 g, 4°C, 20 min) to obtain supernatant fraction for measurement of GST, GR, GPx, and CAT activities and protein content. The enzyme activities were normalized and expressed per mg of protein content. Protein level was quantified by a spectrophotometric method using bicinchoninic acid [
The level of DEET in water was determined by gas chromatography with ion trap mass spectrometry. A sample was extracted in cyclohexane (4 mL samples: 4 mL cyclohexane). The separation, identification, and quantification of DEET were carried out using a Varian 450-GC gas chromatograph with 220-MS ion trap mass spectrometer and VF-5 ms (30 m × 0.25 mm) column (Varian, Inc., USA). A 1
Samples of liver, gills, cranial, and caudal kidney were removed from 5 fish in each group. They were fixed in 10% neutral formalin solution and subsequently stained with haematoxylin and eosin. Histological changes in samples were examined by light microscopy.
Statistical analysis was performed using Unistat 5.6 software. A Shapiro-Wilk test was done for the normal distribution. The differences among test groups were assessed with the Tukey-HSD test. Immunological parameters were evaluated by the unpaired nonparametric Mann-Whitney test.
During the experiment, the mortality of fish was not recorded in both control groups as well as in the tested concentrations.
There were no changes in HSI and CF in fish exposed to all DEET concentrations compared to both control groups after 28 days of exposure (Table
Biometric parameters in
Parameter | Control | Control with DMSO | DEET 1 µg/L | DEET 0.1 mg/L | DEET 1 mg/L |
---|---|---|---|---|---|
Body weight (g) |
|
|
|
|
|
CF |
|
|
|
|
|
HSI |
|
|
|
|
|
The DEET exposure did not affect WBC, MCHC, values of Hb, and PCV of experimental fish. A significant increase (
Haematological values in
Indices | Control | Control with DMSO | DEET 1 µg/L | DEET 0.1 mg/L | DEET 1 mg/L |
---|---|---|---|---|---|
RBC (1012/L) | 1.69 ± 0.35a | 1.78 ± 0.41a | 2.21 ± 0.74a,b | 2.20 ± 0.62a,b | 2.49 ± 0.42b |
Hb (g/L) |
|
|
|
|
|
PCV (L/L) |
|
|
|
|
|
MCV (1015/L) | 162.11 ± 34.65a | 159.54 ± 34.23a | 134.76 ± 52.87a,b | 128.68 ± 41.65a,b | 107.27 ± 18.43b |
MCH (1012/L) | 44.12 ± 11.73a | 39.75 ± 8.36a,b | 36.35 ± 11.51a,b | 32.66 ± 10.30a,b | 29.88 ± 9.31b |
MCHC (g/L) |
|
|
|
|
|
Significant differences (
WBC and differential white blood cells count were not affected by treatment (data not shown).
The only change in biochemical profile of the experimental fish was in the decrease (
Biochemical indices in plasma of
Indices | Control | Control with DMSO | DEET 1 µg/L | DEET 0.1 mg/L | DEET 1 mg/L |
---|---|---|---|---|---|
ALT (µkat/L) |
|
|
|
|
|
AST (µkat/L) |
|
|
|
|
|
ALP (µkat/L) |
|
|
|
|
|
Albumin (g/L) |
|
|
|
|
|
Total protein (g/L) |
|
|
|
|
|
Glucose (mmol/L) |
|
|
|
|
|
LDH (µkat/L) |
|
|
|
|
|
TAG (mmol/L) | 2.37 ± 2.34a | 2.12 ± 0.73a,b | 2.21 ± 0.99a,b | 2.15 ± 1.60a,b | 1.88 ± 1.30b |
Ammonium (mmol/L) |
|
|
|
|
|
Calcium (mmol/L) |
|
|
|
|
|
Phosphorus (mmol/L) |
|
|
|
|
|
Lactate (mmol/L) |
|
|
|
|
|
Cholesterol (mmol /L) |
|
|
|
|
|
FRAP (Fe2+ equivalent µmol/L) |
|
|
|
|
|
ButChE (µkat/L) |
|
|
|
|
|
Significant differences (
The exposure to DEET did not influence proinflammatory (TNF-
Graphs show individual values of the expression of cytokines versus housekeeping gene
Values of antioxidant enzymes activities (GR, GPx, GST, and CAT) and amount of TBARS are presented in tables for individual tissue (Tables
Antioxidant enzymes activities and amount of TBARS in liver of
Parameter | Units | Control | Control with DMSO | DEET 1 µg/L | DEET 0.1 mg/L | DEET 1 mg/L |
---|---|---|---|---|---|---|
GR | (nmol NADPH/min/mg protein) |
|
|
|
|
|
GPx | (nmol NADPH/min/mg protein) |
|
|
|
|
|
GST | (nmol /min/mg protein) |
|
|
|
|
|
CAT | (µmol H2O2/min/mg protein) |
|
|
|
|
|
TBARS | (nmol/g sample) |
|
|
|
|
|
Antioxidant enzymes activity and amount of TBARS in kidney of
Parameter | Units | Control | Control with DMSO | DEET 1 µg/L | DEET 0.1 mg/L | DEET 1 mg/L |
---|---|---|---|---|---|---|
GR | (nmol NADPH/min/mg protein) |
|
|
|
|
|
GPx | (nmol NADPH/min/mg protein) | 193.4 ± 33.1a,b | 183.7 ± 45.7b | 164.9 ± 39.4a,b | 201.7 ± 29.8a,b | 221.8 ± 31.4a |
GST | (nmol/min/mg protein) |
|
|
|
|
|
CAT | (µmol H2O2/min/mg protein) |
|
|
|
|
|
TBARS | (nmol/g sample) |
|
|
|
|
|
Significant differences (
Antioxidant enzymes activity and amount of TBARS in brain of
Parameter | Units | Control | Control with DMSO | DEET 1 µg/L | DEET 0.1 mg/L | DEET 1 mg/L |
---|---|---|---|---|---|---|
GR | (nmol NADPH/min/mg protein) |
|
|
|
|
|
GPx | (nmol NADPH/min/mg protein) |
|
|
|
|
|
GST | (nmol/min/mg protein) |
|
|
|
|
|
TBARS | (nmol/g sample) |
|
|
|
|
|
Antioxidant enzymes activity and amount of TBARS in gills of
Parameter | Units | Control | Control with DMSO | DEET 1 µg/L | DEET 0.1 mg/L | DEET 1 mg/L |
---|---|---|---|---|---|---|
GR | (nmol NADPH/min/mg protein) |
|
|
|
|
|
GPx | (nmol NADPH/min/mg protein) | 43.67 ± 13.94a,b | 54.87 ± 18.11a | 43.09 ± 21.65a,b | 37.31 ± 6.94a,b | 34.28 ± 11.39b |
GST | (nmol /min/mg protein) |
|
|
|
|
|
CAT | (µmol H2O2/min/mg protein) |
|
|
|
|
|
TBARS | (nmol/g sample) |
|
|
|
|
|
Significant differences (
A subchronic exposure to DEET did not cause marked specific histopathological changes in the DEET-treated fish.
The amount of data on mechanism of action and chronic toxicity for DEET to aquatic environment is still limited. Acute toxic studies have found DEET to be slightly toxic for fish: 96 h LC50 for tilapia mossambica (
The decrease in triacylglycerides in DEET concentration 1 mg/L was recorded. TAG are the most important energy-storing lipids and belong to major energy sources for the fish [
Because DEET is reported to act as a neurotoxin through inhibition of cholinesterase [
The immunological toxicity of DEET has not been extensively studied in fish before. Our observation was focused on the expression of proinflammatory (TNF-
The effect of DEET on formation of oxidative stress was studied especially in insect [
Fish are an appropriate model for a further investigation of the biological effect of DEET on vertebrates due to its high frequency of occurrence in aquatic environments around the world. Although acute toxicity levels of DEET are high, low concentration after subchronic exposition can cause adverse effects on haematological parameters. To assess the effect of diethyltoluamide on the fish immune system, more immunological parameters need to be included in the future studies.
The authors declare that there is no conflict of interests regarding the publication of this paper.
This study was supported by IGA VFU 17/2013/FVHE and Ministry of Education, Youth and Sports, Czech Republic (CZ 1.05/2.1.00/01.0006; ED 0006/01/01 AdmireVet).