Platelet-rich plasma (PRP) is injected within tendons to stimulate healing. Metabolic alterations such as the metabolic syndrome, diabetes, or hyperuricemia could hinder the therapeutic effect of PRP. We hypothesise that tendon cells sense high levels of uric acid and this could modify their response to PRP. Tendon cells were treated with allogeneic PRPs for 96 hours. Hyperuricemic PRP did not hinder the proliferative actions of PRP. The gene expression pattern of inflammatory molecules in response to PRP showed absence of IL-1b and COX1 and modest expression of IL6, IL8, COX2, and TGF-b1. IL8 and IL6 proteins were secreted by tendon cells treated with PRP. The synthesis of IL6 and IL8 proteins induced by PRP is decreased significantly in the presence of hyperuricemia (
The use of platelet-rich plasma (PRP) to treat tendon pathology has widely expanded in the last five years [
PRP injection is an autologous treatment derived from the patient’s own blood; thus metabolic alterations such as the metabolic syndrome, diabetes, or hyperuricemia could hinder the therapeutic effect of autologous PRP in these patients. Despite a higher risk of suffering tendinopathy [
Hyperuricemia is a relatively common metabolic disease with a prevalence of more than 10% in certain populations [
Additionally, extracellular uric acid concentration rises locally upon cell death. In fact, cells normally contain very high levels of uric acid intracellularly [
Previous studies have described the pathophysiological role of MSU crystals in alerting the immune system to danger, and the possibility of suffering harm is sensed by monocytes/macrophages that drive an inflammatory reaction by releasing active IL-1b [
We raised the hypothesis that tendon cells sense elevated levels of uric acid and this could modify their response to PRP. We explored whether hyperuricemic PRP induces inflammatory, phenotypic, or metabolic changes in tendon cells. To test this hypothesis, we examined in parallel the response of tendon cells to PRP and hyperuricemic PRP exposure by assessing the expression of specific tendon tissue molecules, including type 1 collagen (COL1A1), scleraxis (SCX), decorin (DCN), tenomodulin (TNMD), cartilage oligomeric protein (COMP), and aggrecan (ACAN). In addition, the expression of molecules that characterize early tissue repair such as type 3 collagen (COL3A1) and hyaluronan synthase 2 (HAS2) was determined as well as the expression of inflammatory modulators IL-1b, IL-8, COX-1, and COX2. Finally, we have explored whether hyperuricemic PRP may influence the synthesis of pleiotropic cytokines such as TGF-beta1 and IL-6, which might have a role in enhancing collagen synthesis [
We have used primary tendon cells (up to passage 3) isolated from three young male healthy donors (T1, T2, and T3) of similar age (
Human tendon samples were obtained, under anonymous conditions, from three young healthy patients during anterior cruciate ligament reconstruction surgery with semitendinosus tendon, after informed consent and local ethic committee approval. Tendon fragments, which otherwise would have been discarded, were minced and incubated with active 0.3% Collagenase II (Gibco, Life Technologies) at 37°C for 40 min. The cell suspension was centrifuged, resuspended in DMEM F-12 (Gibco, Life Technologies) supplemented with 5% Penicillin/Streptomycin solution (5,000 U/mL Pen. 5,000
Pure PRP, the same formulation we use in clinical applications, was obtained by single spin method as previously described [
Platelet activation and lysis were performed by three freeze thaw cycles, then filtered through 0.22
Cells were harvested from T75 flasks after trypsinization (TryPLE select, Gibco, Life Technologies) and seeded in 96-well plates (Corning) at a density of 4000 cells/cm2 and starved overnight before treatments were performed. Cells were treated with PRP lysate or hyperuricemic PRP lysate from the six donors; in parallel, as a reference, cells were cultured with 10% FBS. Cell proliferation was measured at 0, 24, 48, 72, and 96 h with the XTT method.
Population doubling time was used to determine proliferation rate as a total culture time divided by the number of generations calculated as
Total RNA was extracted from tenocytes at passages 2-3, after 4 days of PRP treatment using High Pure RNA Isolation Kit (Roche), following manufacturer instructions. RNA concentrations were measured with the NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA).
1
We assessed gene expression for tendon tissue markers scleraxis (SCX), decorin (DCN), tenomodulin (TNMD), matrix proteins including COMP, COL1A1, and COL3A1, and the enzyme for HA synthesis, HAS2. In addition, the expression of cartilage markers COL2A1, aggrecan, and SOX9 was assessed. Likewise inflammatory modulators such as IL-1b, COX1, COX2, and pleiotropic cytokines including IL-6, IL-8, and TGF-beta1 were assessed. Amplification reactions were performed for GAPDH and TBP as reference genes. Primers and annealing temperatures are shown in Table
Real-time PCR primers used in this study.
Gene | Forward primer (5′→3′) | Reverse primer (5′→3′) |
|
---|---|---|---|
SCX | CAGCCCAAACAGATCTGCACCTT | CTGTCTTTCTGTCGCGGTCCTT | 58 |
DCN | GGTGGGCTGGCAGAGCATAAGT | TGTCCAGGTGGGCAGAAGTCA | 58 |
TNMD | GAAGCGGAAATGGCACTGATGA | TGAAGACCCACGAAGTAGATGCCA | 60 |
COMP | CCGACAGCAACGTGGTCTT | CAGGTTGGCCCAGATGATG | 55 |
ACAN | ACAGCTGGGGACATTAGTGG | GTGGAATGCAGAGGTGGTTT | 55 |
SOX9 | AGCGAACGCACATCAAGAC | GCTGTAGTGTGGGAGGTTGAA | 55 |
COL1A1 | GGCAACAGCCGCTTCACCTAC | GCGGGAGGACTTGGTGGTTTT | 58 |
COL3A1 | CACGGAAACACTGGTGGACAGATT | ATGCCAGCTGCACATCAAGGAC | 58 |
COL2A1 | AACCAGATTGAGAGCATCCG | AACGTTTGCTGGATTGGGGT | 55 |
HAS2 | GTCCCG GTGAGACAGATGAG | ATGAGGCTGGGTCAAGCATAG | 58 |
IL-1b | TCCAAGGGGACAGGATATGGAGCA | AGGCCCAAGGCCACAGGTATTT | 58 |
IL-6 | GAGGCACTGGCAGAAAACAACC | CCTCAAACTCCAAAAGACCAGTGATG | 58 |
IL-8 | CTGTCTGGACCCCAAGGAAAACT | GCAACCCTACAACAGACCCACAC | 57 |
COX1 | GGTTTGGCATGAAACCCTACACCT | CCTCCAACTCTGCTGCCATCT | 58 |
COX2 | AACTGCGCCTTTTCAAGGATGG | TGCTCAGGGACTTGAGGAGGGT | 58 |
TGF-beta1 | GAGGTCACCCGCGTGCTAATG | CACGGGTTCAGGTACCGCTTCT | 58 |
GAPDH | GCATTGCCCTCAACGACCACT | CCATGAGGTCCACCACCCTGT | 58 |
TBP | TGCACAGGAGCCAAGAGTGAA | CACATCACAGCTCCCCACCA | 58 |
Scleraxis (SCX), decorin (DCN), tenomodulin (TNMD), cartilage oligomeric protein (COMP), aggrecan (ACAN), SRY (sex determining region Y)-box 9 (SOX9), collagen type I alpha 1 (COL1A1), collagen type 3 alpha 1 (COL3A1), collagen type II alpha 1 (COL2A1), hyaluronan synthase 2 (HAS2), interleukin 1, beta (IL-1b), interleukin-6 (IL-6), interleukin-8 (IL-8), cytochrome c oxidase 1 (COX1), cytochrome c oxidase 2 (COX2), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and TATA box binding protein (TBP).
To assess the effect of hyperuricemia, relative expression levels were normalized to the average of GAPDH and TBP, and gene expression data were calculated as fold versus control using the
IL-6 and IL-8 were measured in cell culture supernatants using EASIA kits (Invitrogen, Life Technologies). The procedures were performed according to the manufacturer’s instructions. Briefly, the reaction was detected by peroxidase-conjugated streptavidin followed by a substrate mixture that contained hydrogen peroxidase as a substrate and ABTS as chromogen. The absorbance was measured in a microplate ELISA reader (PolarStar Omega, BMG Labtech, Offenburg, Germany) at 450 nm, and the concentration was calculated using standard curves. The contribution of 10% PRP was subtracted in order to obtain the cytokine amount produced by cells.
The experiments were performed in triplicate for each of the six PRP donors per three tendon donors. The effects of PRP on proliferation are shown as means ± standard deviation (SD). The effect of PRP on tendon cells expression is shown as median and 25–75 percentiles. Spearman coefficient was used to describe correlations. The effect of hyperuricemic PRP was expressed as the mRNA ratio of hyperuricemic PRP versus PRP expression.
After 96 hours in culture, PRP significantly enhanced tendon cell proliferation when compared to FBS (
Hyperuricemia did not affect cell proliferation; the tenocyte numbers increased by 548% and 545.5%, respectively (
Representative images of tendon cells (passage 2) (a) treated with PRP for 96 hours and (b) treated with hyperuricemic PRP for 96 hours, magnification 20x.
After 96 hours of treatment with PRP, the tendon cells showed modest expression of IL-6, IL-8, and COX2 (Table
Relative gene expression normalised to the mean of GAPDH and TBP (
Cell donor | SCX | HAS2 | COLA1 | COLA3 | COMP | DCN | IL6 | COX2 | IL8 | ACAN | TGF-b1 |
---|---|---|---|---|---|---|---|---|---|---|---|
T1 |
|
|
|
|
|
|
|
|
|
|
|
|
|||||||||||
T2 |
|
|
|
|
|
|
|
|
|
|
|
|
|||||||||||
T3 |
|
|
|
|
|
|
|
|
|
|
|
Relative expression levels of tendon cells from three donors (T1, T2, and T3) treated with allogeneic PRP (six donors) for 96 hours, normalised to the mean of GAPDH and TBP (
Scleraxis (SCX), decorin (DCN), tenomodulin (TNMD), cartilage oligomeric protein (COMP), aggrecan (ACAN), SRY (sex determining region Y)-box 9 (SOX9), collagen type I alpha 1 (COL1A1), collagen type 3 alpha 1 (COL3A1), collagen type II alpha 1 (COL2A1), hyaluronan synthase 2 (HAS2), interleukin-1, beta (IL-1b), interleukin-6 (IL-6), interleukin-8 (IL-8), cytochrome c oxidase 1 (COX1), cytochrome c oxidase 2 (COX2), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and TATA box binding protein (TBP).
The levels of IL-1beta and COX1 were not detectable (Ct > 32) when tendon cells were treated with PRP or hyperuricemic PRP. COX2 was significantly stimulated by hyperuricemia in T1 but not in T2. There was evidence of expression and synthesis of two pleiotropic interleukins, IL-8 (CXCL8) and IL-6 (CXCL6), in the conditioned media. Constitutive synthesis of interleukins was IL-6, 416 pg/mL (range 328–503) and IL-8 166 pg/mL (range 123–196). PRP induced a 3-fold increase over constitutive values for IL-6 and 9.6-fold for IL-8. Notwithstanding, hyperuricemic PRP induced a 2-fold increase of IL-6 and 3-fold increase of IL-8 over constitutive values. Remarkably, the expression and synthesis of IL-6 and IL-8 induced by PRP are decreased significantly in the presence of hyperuricemia (Figures
Boxplots of modulators of inflammation. Boxes illustrate the relative mRNA expression of modulators of inflammation (TGF-b1, COX2, IL-6, and IL-8); the band inside the box is the median. mRNA folds of hyperuricemic PRP treated cells are calculated relative to PRP treated cells. IL-8 expression is significantly reduced in cells treated with hyperuricemic PRP.
Synthesis of IL-6 and IL-8 proteins. The concentration of IL-6 and IL-8 is reduced in tendon cells treated with hyperuricemic PRP compared to cells treated with PRP. Data are compared using the Wilcoxon signed-rank test for matched samples.
These findings corroborate changes in the inflammatory response to PRP induced by hyperuricemia.
There was evidence of a statistically significant positive association between COX2 and IL-6 (
Taken together, these results could indicate coregulation of some proteins and can be used to infer that a greater inflammatory cell response to the molecular environment is associated with cell dedifferentiation and a decreased synthesis of aggrecan.
In hyperuricemic PRP conditions, the expression of type 1 collagen was significantly increased (
Relative expression of (a) fibrillar extracellular matrix proteins and (b) nonfibrillar extracellular matrix proteins in tendon cells treated with hyperuricemic PRP compared with cells treated with PRP.
The expression of HAS2, the enzyme involved in hyaluronan synthesis, was significantly reduced in hyperuricemic PRP compared with PRP (
We explored whether tendon cells can sense hyperuricemia in their biological milieu and whether hyperuricemic PRP can incite tendon cells to switch to an inflammatory phenotype. We found that PRP induces a modest inflammatory molecular response in tendon cells compared to constitutive values and that hyperuricemia can mitigate this reaction. Furthermore, we report that hyperuricemia modifies the expression pattern of extracellular matrix proteins induced by PRP treatment.
One possible way of investigating whether hyperuricemia may affect inflammation and tendon metabolism is to expose primary tendon cells to hyperuricemic PRP
To achieve the greatest approximation to the
These cells exposed to PRP for 96 hours could be an acceptable representation of the
One of the central observations in this study is that PRP induces modest inflammation, evidenced by the production of IL-6, IL-8, COL1A1, and COX2. Analogous to our
The synthesis of IL-6 is also reduced by hyperuricemia. IL-6 may play a crucial role in tendon healing as tendon healing was significantly reduced in IL-6 knockout mice [
How cells sense uric acid is not clear. In particular, our experiments show that tendon cells sense uric acid but whether it could occur via TLR2 as in chondrocytes is unexplored [
Priming TLR2 and TLR4 with other molecules such as SAA induced TLR-dependent production of IL-6 and IL-8 and facilitated the inflammatory actions of MSU in synoviocytes [
Our results corroborate the idea that only crystallised uric acid induces inflammation. Indeed, in our experimental conditions, hyperuricemic PRP further enhanced the synthesis of type I collagen and reduced the synthesis of IL-6 and IL-8. This reduction may hinder the regenerative effects of PRP, assuming that they are linked to angiogenesis and inflammation.
The present results set the rationale for performing future
Our study has several limitations and from these data it is difficult to reach conclusions to be extrapolated to
In conclusion, we show that hyperuricemic PRP may exert a positive effect on tendons by increasing the production of type 1 collagen and COMP, and at the same time decreasing the production of IL-6 and IL-8. Thus, a priori, patients with hyperuricemia shall not be excluded from PRP treatment. However, not only local tenocytes but also infiltrated innate immune cells respond to PRP cues. Therefore, depending on the immunological microenvironment and the reciprocal interactions, local cells can acquire distinct functional properties.
The authors declare that there is no conflict of interests regarding the publication of this paper.
This work was supported by SAIO2012-PE12BF007.