Ankylosing spondylitis (AS) is a member of a group of rheumatic diseases that affects the axial joints (spine and pelvis), collectively known as spondyloarthropathies. It is a common disease affecting approximately 0.5% of white Europeans and has a global distribution with the exception [
MicroRNAs are endogenous ~22 nt RNAs that comprise one of the more abundant classes of gene regulatory molecules in multicellular organisms and likely influence the output of many protein-coding genes [
It was validated that microRNA disorder was related to pathogenesis of rheumatism. Expression of miR-132 and 3 other microRNAs differentiated patients with RA or OA from HC [
Forty patients who fulfilled the Modified New York Criteria for Ankylosing Spondylitis (1984) were included in this study. It was demanded that the Bath Ankylosing Spondylitis Disease Activity Index (BASDAI) [
PBMCs of 35 AS patients and 47 controls were extracted by using lymphocytes separation medium. Total RNA and microRNAs of each sample were isolated according to manufacturer’s protocol of TRIzol Reagent (Life Technologies, Inc.) and mirVana microRNA Isolation Kit (Ambion, Inc.). To confirm that the report of microarray is reliable, the OD value (DU520 UV/Vis Spectrophotometer, Beckman Coulter, Ltd) and electrophoresis (Bio-Rad Mini-Sub GT System, Bio-Rad, Ltd) were used to evaluate the quantity and quality of total RNA. Then microRNAs were marked with Monoreactive Cy3 dye (Amersham Pharmacia Biotech, Ltd) and purified according to mirVana microRNA Labeling Kit (Ambion, Inc.) procedure. Prepared microRNAs were hybridized to microarray probes. 428 microRNAs probes were involved, and all of them were 34–44 nt and had the same Tm value. Fluorescent signals were scanned (Generation iii array scanner, Amersham Pharmacia) and translated into digital signals (Imagequant 5.0, Array Vision 6.0). Relative expression levels of target microRNAs were estimated according to digitized intensity of fluorescence. Calibrator was the median of all the valid data. Average microRNA expression level of each group and the ratio of any two of the three groups (AS patients before treatment, AS patients after treatment, and healthy donors) were independently calculated. Because only CY3 was used to mark target microRNA, the ratio >3 or <0.33 was thought to be statistically significant.
Thirteen microRNAs were chosen for validation, as follows. The relative expression levels of target microRNAs fulfilled being (a) significantly different between AS patients and healthy donors, (b) increasing/decreasing dramatically after regular etanercept therapy, or (c) taking part in the process of inflammation or bone metabolism according to the papers published before. Reverse transcription was performed according to the protocol. Real-time polymerase chain reaction (PCR) was performed on MX-3000P Real-Time PCR Instrument (Stratagen, US) using Beacon Real-Time PCR Universal Reagent (Cat# GMRS-001, GenePharma, Shanghai) and with U6 snRNA as the internal control. Primers were designed as follows. 10 samples of AS patient and 10 control samples were included in pilot real-time PCR experiment. Two microRNAs, hsa-miR-29a and hsa-miR-126-3p, were involved in next step real-time PCR validation. Sample size of each group was enlarged in further study. Relative copy numbers of target microRNAs were obtained. The expression levels of target microRNAs in each sample were calculated according to the copy numbers of target microRNAs. A fold change of >2 was considered significant.
Primers were designed as follows: hsa-miR-let7a (F primer: GGACTGAGGTAGTAGGTT, R primer: CATCAGATGCGTTGCGTA), hsa-miR-let7f (F primer: GGACTGAGGTAGTAGATTG, R primer: CATCAGATGCGTTGCGTA), hsa-miR-let7i (F primer: GGACCTGCGCAAGCTAC, R primer: CATCAGATGCGTTGGCTA), hsa-miR-21 (F primer: GGACTAGCTTATCAGACTG, R primer: CATCAGATGCGTTGCGTA), hsa-miR-26b (F primer: GGACTTCAAGTAATTCAGGA, R primer: CATCAGATGCGTTGCGTA), hsa-miR-27a (F primer: GGACTTCACAGTGGCTAA, R primer: CATCAGATGCGTTGCGTA), hsa-miR-29a (F primer: GGACTAGCACCATCTGAA, R primer: CATCAGATGCGTTGCGTA), hsa-miR-29b (F primer: GGACTAGCACCATTTGAAA, R primer: CATCAGATGCGTTGCGTA), hsa-miR-98 (F primer GGACTGAGGTAGTAAGTTG, R primer: CATCAGATGCGTTGCGTA), hsa-miR-202 (F primer: GGACTTCCTATGCATATAC, R primer: CATCAGATGCGTTGCGTA), hsa-miR-494 (F primer: GGACTGAAACATACACGG, R primer: CATCAGATGCGTTGCGTA), hsa-miR-526a (F primer: GGACCTCTAGAGGGAAG, R primer: CATCAGATGCGTTGCGTA), hsa-miR-126-3p (F primer: GGACTCGTACCGTGAGTA,R primer: CATCAGATGCGTTGCGTA).
Data were presented as the mean ± standard deviation. Statistical analyses were performed using SPSS 10.0. Differences between two groups were analyzed with Wilcoxon rank sum test. Correlations of clinical presentations and microRNA expression levels were also analyzed. Spearman correlation coefficients were calculated. A
There were 40 AS patients and 50 healthy volunteers included in this study. The male to female ratio and average age in the AS patients group matched with the healthy control group. Means of disease duration, BASDAI, BASFI, CRP, ESR, and medications used were calculated (Table
Clinical features of the AS participants.
Characteristics | AS ( |
---|---|
Disease duration, mean ± SD years | 7.9 ± 0.8 |
BASDAI, mean ± SD | 5.25 ± 1.62 |
BASFI, mean ± SD | 46.5 ± 23.6 |
CRP, mean ± SD mg/L | 30.5 ± 23.5 |
ESR, mean ± SD mm | 39.9 ± 29.5 |
Medications before etanercept therapy, taking/not taking | |
Steroids, last 3 months | 6/34 |
DMARDs, last 3 months | 27/13 |
NSAIDs, last 1 month | 29/11 |
AS, ankylosing spondylitis; HC, healthy control; SD, standard deviation; BASDAI, Bath Ankylosing Spondylitis Disease Activity Index; BASFI, Bath Ankylosing Spondylitis Functional Index; CRP, C-reactive protein; ESR, erythrocyte sedimentation rate; DMARDs, disease-modifying antirheumatic drugs; NSAIDs, nonsteroidal anti-inflammatory drugs.
According to the microarray, there were 26 significantly differentially expressed microRNAs. The expression levels of all the microRNAs were significantly higher in AS group than in control group (fluorescence intensity ratio of AS group to control group was >3 : 1) (Figure
Calibrated fluorescence intensity of microarray in different groups. (a) The microRNAs signal intensity of AS group was compared with that of healthy control. There were 31 microRNAs in this figure. 26 of them, at the left side of the figure, expressed significantly higher in AS group than in HC. The other 5, at the right side of the figure, were probably higher in AS group than in control group. (b) The microRNAs signal intensity of AS group before and after etanercept therapy was compared. There were 36 microRNAs in this figure. 23 of them, at the left side of the figure, had definite expression regulation after therapy. Among them, the expression levels of 6 downregulated significantly after regular etanercept therapy, while 17 upregulated. However, the other 13 microRNAs, at the right side of the figure, were thought to keep different expression levels, not so dramatically changed in AS group before and after etanercept therapy. 7 among them downregulated, while 6 upregulated. AS, ankylosing spondylitis; HC, healthy control.
However, hsa-miR-15a, hsa-miR-515-3p, hsa-miR-198, hsa-miR-494, and hsa-miR-142-3p were probably higher in AS group than in control group (fluorescence intensity ratio of AS group to control group was >2 : 1 but <3 : 1) (Figure
It was necessary to point out that there were 9 differentially expressed microRNAs. All of them had higher expressed levels in AS group than healthy control group. However the expression levels of these microRNAs downregulated after regular etanercept therapy for 12 weeks (Figure
Nine microRNAs had higher expressed levels in AS group than healthy control group, and the expression levels of them downregulated after regular etanercept therapy for 12 weeks. The calibrated signal ratio of AS group before therapy to healthy control group were >3 : 1, and the ratio of AS group after therapy to before therapy were <1 : 3. HC, healthy control; AS, ankylosing spondylitis.
Real-time PCR was performed on 13 candidate microRNAs (
Expression level of microRNAs in both AS and control group validated by real-time PCR.
microRNA |
| |
---|---|---|
AS group/control group (interval) | AS group before/after therapy (interval) | |
hsa-miR-202 | 1.28 (0.28~5.88) | 0.50 (0.13~2.08) |
hsa-miR-21 | 0.51 (0.11~2.5) | — |
hsa-miR-26b** | 0.70 (0.26~1.89) | 3.43 (1.20~9.85) |
hsa-miR-27a* | 0.07 (0.01~0.58) | 0.8 (0.27~2.43) |
hsa-miR-29a** | 0.26 (0.12~0.53) | 0.35 (0.25~1.24) |
hsa-miR-29b** | 1.22 (0.67~2.22) | 0.43 (0.19~0.97) |
hsa-miR-494** | 0.58 (0.52–5.6) | 0.21 (0.05~0.89) |
hsa-miR-526a** | 1.20 (0.48~3.03) | 0.40 (0.13~1.14) |
hsa-miR-98* | 0.44 (0.10~1.89) | — |
hsa-miR-let7a | 0.91 (0.16~4.76) | — |
hsa-miR-let7f | 0.54 (0.11~2.70) | — |
hsa-miR-let7i*,** | 0.27 (0.05~1.49) | 0.27 (0.05~1.47) |
hsa-miR-126-3p* | 0.15 (0.03~0.75) | 0.51 (0.28~0.93) |
**Expression levels were changed statistically significantly after medicine treatment (fold changes >2,
Further validated study involved the 2 microRNA, hsa-miR-126-3p and hsa-miR-29a. As we anticipated, the result of further study was infusive. The expression levels of these 2 microRNAs were significantly lower in AS group (PCR values: 3.52 ± 3.76 and 7.26 ± 5.18;
Expression of two microRNAs by real-time PCR validated.
microRNA |
| |||
---|---|---|---|---|
Control group/AS group (fold) |
|
AS group before/after therapy (fold) |
|
|
hsa-miR-29a | 16.22 (16.22) | 0.002 | 0.31 (3.18) | 0.049 |
hsa-miR-126-3p | 3.76 (3.76) | 0.046 | 0.45 (2.20) | 0.035 |
The expression levels of these 2 microRNAs were significantly lower in AS group than in control group. And expressions of them were dramatically upregulated after 12-week etanercept treatment (fold changes >2,
Correlation analysis of 2 microRNAs, hsa-miR-126-3p and hsa-miR-29a, expression and clinical data indicated that hsa-miR-126-3p expression disorders statistically significantly correlated with CRP and ESR (Table
Correlation of 2 validated microRNAs and clinical presentation.
BASDAI | CRP | ESR | ||||
---|---|---|---|---|---|---|
Correlation coefficients |
|
Correlation coefficients |
|
Correlation coefficients |
| |
hsa-miR-126-3p | 0.302 | 0.059 | 0.317 | 0.046 | 0.378 | 0.016 |
hsa-miR-29a |
|
0.843 | 0.207 | 0.282 | 0.153 | 0.429 |
MicroRNAs expression disorders did not statistically significantly correlated with BASDAI, CRP, or ESR. BASDAI, Bath Ankylosing Spondylitis Disease Activity Index; CRP, C-reactive protein; ESR, erythrocyte sedimentation rate; correlation coefficients, Spearman correlation coefficients;
Since the discovery of microRNA, lin-4, in 1993 at Harvard [
Our hypothesis was that microRNAs took part in pathogenesis of AS. According to this hypothesis, we could infer that (a) expression of microRNAs was disorder in active stage of AS; (b) when the clinical presentations were controlled, the expression of microRNAs would tend to be normal. For one thing, the expression levels of hsa-miR-126-3p and hsa-miR-29a were lower in AS group than in healthy control group. The differences between the two groups were statistically significant. And the expressions of hsa-miR-126-3p and hsa-miR-29a were significantly upregulated in AS group after 12-week therapy taking baseline as control. Unfortunately, it was not certified that expression disorders of microRNAs and clinical parameters of AS activity (BASDAI, CRP, and ESR) correlated linearly. At least there were three reasons that shouldered the responsibility. Firstly, microRNAs disorders and alterations of clinical parameters maybe have complex correlation, not linear, which would be affected and regulated by many factors. Secondly, clinical parameters reflected just inflammatory activity of AS, while microRNAs disorders may be related to bone metabolism. Relative clinical parameters could be collected to validate this hypothesis in the future. Thirdly, appearance of microRNAs disorders and clinical presentations may lack temporal concurrence, while data collection was performed at the same time point. Under the circumstances the result would not reflect their real correlation.
On the basis of our hypothesis, microRNAs, hsa-miR-126-3p and hsa-miR-29a, are probably potential diagnostic biomarkers for AS. As reported in the field of malignant tumors [
Our research provides clues of further researches. MicroRNAs play a special role in gene regulation [
PBMCs microRNAs expressions profile of AS patients was distinct from these of healthy donors. Our study first verified AS pathogenesis involved dysregulation of microRNAs. Expression levels of two microRNAs, hsa-miR-126-3p and hsa-miR-29a, were distinct from these of healthy controls. And after regular etanercept therapy, the dysregulation of microRNAs expression could be corrected. They will probably become not only the potential biomarkers for AS diagnosis, activity evaluation, and curative effect monitoring, but also provocative therapeutic targets of AS.
Ribonucleic acid
Peripheral blood mononuclear cell
Ankylosing spondylitis
Polymerase chain reaction
Bath Ankylosing Spondylitis Disease Activity Index
Bath Ankylosing Spondylitis Functional Index
C-reactive protein
Erythrocyte sedimentation rate
Disease-modifying antirheumatic drugs
Nonsteroidal anti-inflammatory drugs
Human leukocyte antigen
Rheumatoid arthritis
Osteoarthritis
Systemic lupus erythematosus
Visual Analogue Score
Ethylenediaminetetraacetic acid
Optical density
Interferon
Interleukin
Tumor necrosis factor
Healthy control
Standard deviation.
The authors declare that they have no conflict of interests.
Jieruo Gu carried out experimental design, Qing Lv and Qiuxia Li carried out experimental analysis and data statistics, Peizhuo Zhang and Yingjuan Jiang carried out experiment of microarray, Xinwei Wang carried out RNA purification, Qiujing Wei carried out collection of samples, Shuangyan Cao, Zetao Liao, Zhiming Lin, Yunfeng Pan, Jianlin Huang, Tianwang Li, Ou Jin and Yuqiong Wu carried out collection of clinical data. Qing Lv and Qiuxia Li contributed equally to this work.
Jieruo Gu has received grant support from the National Natural Sciences Foundation of China (30872328), Clinical Subject (2007 and 2010) of Ministry of Public Health of China and from the Foundation of Guangdong province of China (2009B080701086) and 5010 Subject of Sun Yat-sen University (2009-2010).