Epithelial ovarian cancer is the most aggressive and deadly form of ovarian cancer and is the most lethal gynecological malignancy worldwide; therefore, efforts to elucidate the molecular factors that lead to epithelial ovarian cancer are essential to better understand this disease. Recent studies reveal that tumor cells release cell-secreted vesicles called exosomes and these exosomes can transfer RNAs and miRNAs to distant sites, leading to cell transformation and tumor development. The RNA-binding protein LIN28 is a known marker of stem cells and when expressed in cancer, it is associated with poor tumor outcome. We hypothesized that high LIN28 expressing ovarian cancer cells secrete exosomes that can be taken up by nontumor cells and cause changes in gene expression and cell behavior associated with tumor development. IGROV1 cells were found to contain high LIN28A and secrete exosomes that were taken up by HEK293 cells. Moreover, exposure to these IGROV1 secreted exosomes led to significant increases in genes involved in Epithelial-to-Mesenchymal Transition (EMT), induced HEK293 cell invasion and migration. These changes were not observed with exosomes secreted by OV420 cells, which contain no detectable amounts of LIN28A or LIN28B. No evidence was found of LIN28A transfer from IGROV1 exosomes to HEK293 cells.
Epithelial ovarian cancer (EOC) is the most lethal gynecological malignancy worldwide and is often detected in late stages where metastasis has occurred [
MicroRNAs (miRNAs) are abundantly expressed in human cancers [
LIN28 is a RNA-binding protein that regulates both mRNA and miRNAs. There are two paralogs of LIN28, LIN28A, and LIN28B, both containing a cold shock domain (CSD) and CCHC-zinc finger RNA-binding domain. They regulate
The goal of this study was to test the hypothesis that exosomes from ovarian cancer cells that contain high LIN28 can be taken up by HEK293 cells and lead to changes in gene expression and cell phenotype, whereas exosomes from ovarian cancer cells with low LIN28 levels cannot. To this end we used IGROV1 and OV420 cells; IGROV1 cells can induce peritoneal carcinomatosis in SCID mice, leading to rapid tumor formation and cell growth [
IGROV1 and OV420 cell lines were cultured in Roswell Park Memorial Institute (RPMI 1640) medium with L-glutamine 1X (Cellgro, 10-040-CV), supplemented with 10% fetal bovine serum (FBS) (Atlas Biologicals, F-0500-D) and 1% antibiotic-antimycotic solution (Cellgro, 30-0004-Cl). HEK293 (human embryonic kidney) cells were kindly provided by Dr. Russell Anthony (Colorado State University) and were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Cellgro, 10-017-CV) supplemented with 10% fetal bovine serum (Atlas Biologicals, F-0500-D) and 1% antibiotic-antimycotic solution (Cellgro, 30-0004-Cl). Cells were cultured in a standard humidified incubator at 37°C in a 5% CO2 atmosphere.
IGROV1 cells line were stably transduced with pCT-CD63-GFP Cyto-tracers (System Biosciences, CYTO120-VA-1) to create an IGROV1-CD63-GFP cell line used for exosome tracking as per manufacturer’s instructions. Briefly, 1 × 103 IGROV1 cells were seeded onto 24-well plates 24 hours before transfection to allow adhesion and were grown to approximately 60–80% confluency. The cells were transduced with pCT-CD63-GFP at a multiplicity of infection (MOI) of 2000 virus particles per cell with addition of Polybrene (Millipore, TR-1003-G) at a final concentration of 2
Complete RPMI 1640 and DMEM medium was ultracentrifuged (Beckman L8-80) at 100,000 g for 16 hours at 4°C to pellet secreted membrane vesicles less than 1000 nm to obtain vesicle-depleted medium. Sterile filtration was performed on vesicle-depleted medium using a 0.2
For exosome isolation, 1 × 106 cell were seeded onto four 10 cm cell plates (Celltreat, 229690) and cultured in either RPMI 1640 vesicle-depleted medium or DMEM vesicle-depleted medium for three days. Supernatant was collected and centrifuged at 3,000 g for 15 minutes at 4°C to remove cells and cell debris. Supernatant and ExoQuick-TC Exosome precipitation solution (System Biosciences, EXOTC50A-1) were combined in a 5 : 1 dilution (resp.) and exosomes were collected as per manufacturer’s instructions. Briefly, supernatant/ExoQuick-TC biofluid was centrifuged at 1,500 g for 30 minutes at 4°C; biofluid was aspirated and recentrifuged at 1,500 g for 5 minutes at 4°C to remove excess biofluid without disturbance of exosome pellet. Four exosome pellets were combined and either resuspended in 200
Total RNA was extracted from confluent cells lysed in 300
Total RNA was isolated from exosome isolates using TRIzol LS Reagent (Life Technologies, 10296-028). RNA isolation was completed per manufacturer’s instructions with minor modifications. Briefly, exosomes were lysed in 200
Once total RNA was isolated from both cells and exosomes, DNase-free DNase Treatment and Removal kit (Ambion, AM1906) was used on all samples to eliminate genomic DNA contamination. RNA quality and concentration were assessed using the NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, USA). Total RNA absorbance of 260/280 was measured and samples with RNA purity between 1.7 and 2.2 were used for experiments. Samples were stored at −80°C until qPCR was performed.
RT-PCR was performed from total RNA (see above) where 1
Taqman qPCR was performed on cDNA generated from total RNA (see above). cDNA was diluted to a final concentration of 10 ng/rxn for cells and 20 ng/rxn for exosomes and combined with 2x Ssofast Probe Supermix (Bio-Rad, 172-5230) and 20x Taqman Assay Mix (Applied Biosystems). The 20x Taqman Assay Mix Probes (Applied Biosystems) used for this study were as follows:
miRNA qPCR was performed using cDNA diluted to a final concentration of 1.5 ng/rxn and combined with 2x QuantiTect SYBR green PCR master mix, 10x miScript Universal Primer (miScript SYBR Green PCR Kit, Qiagen, 218075). The miRNA PCR primers used for this study are listed in Table
Human miRNA sequences used for qPCR experiments. These sequences were obtained from miRBase program.
miRNA | Sequence (5′-3′) |
---|---|
|
UGAGGUAGUAGGUUGUAUAGUU |
|
UGAGGUAGUAGGUUGUGUGGUU |
|
UGAGGUAGUAGGUUGUAUGGUU |
|
AGAGGUAGUAGGUUGCAUAGUU |
|
UGAGGUAGGAGGUUGUAUAGUU |
|
UGAGGUAGUAGAUUGUAUAGUU |
|
UGAGGUAGUAGUUUGUACAGUU |
|
UGAGGUAGUAGUUUGUGCUGUU |
|
CUAUACAAUCUACUGUCUUUC |
|
CUAUACAAUCUAUUGCCUUCCC |
|
UCUUUGGUUAUCUAGCUGUAUGA |
|
CAAAGUGCUUACAGUGCAGGUAG |
|
UAAGGUGCAUCUAGUGCAGAUAG |
|
UGUGCAAAUCUAUGCAAAACUGA |
|
UGUGCAAAUCCAUGCAAAACUGA |
|
UAAAGUGCUUAUAGUGCAGGUAG |
|
AAGCUGCCAGUUGAAGAACUGU |
|
UGUAAACAUCCUCGACUGGAAG |
|
UGUAAACAUCCUACACUCAGCU |
|
UGUAAACAUCCUACACUCUCAGC |
|
UGUAAACAUCCCCGACUGGAAG |
|
UGUAAACAUCCUUGACUGGAAG |
|
AGGCAAGAUGCUGGCAUAGCU |
|
UAUUGCACUUGUCCCGGCCUGU |
|
UAACACUGUCUGGUAACGAUGU |
|
UAAUACUGCCUGGUAAUGAUGA |
|
UAAUACUGCCGGGUAAUGAUGGA |
|
ACAGGUGAGGUUCUUGGGAGCC |
|
UCCCUGAGACCCUUUAACCUGUGA |
|
UCCCUGAGACCCUAACUUGUGA |
|
CGCAAGGAUGACACGCAAAUUC |
Human Epithelial-to-Mesenchymal Transition (EMT) RT2 Profiler PCR array (SABiosciences, PAHS-090G-4) was used to examine the relative level of 84 genes related to EMT. Total RNA from 4 biological replicates of confluent HEK293 cells (control) and HEK293 cells exposed to IGROV1 cell-secreted exosomes (treatment) was isolated (see above). cDNA (1 ug) was made, diluted and qPCR was performed per manufacturer’s instructions using the LightCycler 480 Real-Time PCR System (Roche Applied Science). The cycling parameters include an initial denaturation step of 10 minutes at 95°C followed by 45 cycles of repeating denaturing at 15 seconds at 95°C and annealing for 1 minute at 60°C with a final cooling step of 5 minutes at 37°C. Biosciences software associated with this Profiling Array was used to determine significant changes in expression level, and EMT-related genes with a fold change of at least 3 were reported.
Cells and exosomes were lysed in M-PER (Thermo Scientific, 78501) supplemented with Halt proteinase inhibitor cocktail (Thermo Scientific, 1 : 100, 87786) and phenylmethanesulfonyl fluoride solution (Boston BioProducts, 1 : 100, PI-120). Cells were centrifuged at 14,000 g for 5 minutes at 4°C, and protein concentration was determined using the bicinchoninic assay (BCA) method (Pierce BCA Protein Assay Kit, Thermo Scientific, 23225). 30 ug of protein from cell lysates and 40 ug of protein from exosomal lysates were diluted in 6x buffer/DTT loading dye and heated to 95°C for 10 minutes, as described previously [
Experiments were carried out using at least two independent biological replicates and the experiments were repeated. Densitometry was calculated by dividing the band volume of the gene of interest over the housekeeping gene GAPDH. Statistical analysis was determined by ANOVA followed by Tukey pairwise comparison (Minitab 17).
For exosome transfers, 1 × 106 IGROV1-CD63-GFP cells were seeded onto 10 cm cell plates (Celltreat, 229690) in complete RPMI 1640 vesicle-depleted medium and grown for 3 days. IGROV1 and OV420 cell-secreted exosomes were isolated from the culture medium using the exosome isolation procedure described above and stained with Vybrant DiD cell-labeling solution (Invitrogen, V22887) per manufacturer’s instructions. 24 hours before exosomes were isolated; 5 × 104 HEK293 cells were grown in complete DMEM vesicle-depleted medium to approximately 60–80% confluency in 4-well plates. Exosomes were resuspended in 500
Migration and invasion assays were performed using the 24-well 8.0
qPCR analysis revealed significantly higher levels of
Levels of LIN28A and LIN28B mRNA and protein in IGROV1, HEK293, and OV420 cells. qPCR was performed to obtain
LIN28A and LIN28B are known regulators of
Relative level of
IGROV1 cells were infected with CD63-GFP-cytotracer, which led to GFP-labeling of exosomes by the host cells. In addition, exosomes secreted by OV420 cells were incubated with the DiD cell-labeling solution, which labels lipids in cell membranes. HEK293 cell incubation with GFP-labeled IGROV1 secreted exosomes or DiD-labeled OV420 secreted exosomes leads to uptake of these exosomes as evident by Z-stack imaging (Figure
Detection of exosome-uptake by HEK293 cells. (a) HEK293 cells after exposure to CD63-GFP positive (green) and DiD-RFP labeled (red) IGROV1 secreted exosomes. 20x magnification was utilized to image HEK293 cells following exosome exposure using confocal microscopy. (b) Z-stack image of HEK293 cells after exposure to CD63-GFP positive (green) and DiD-RFP labeled (red) IGROV1 secreted exosomes. (c) Z-stack image of HEK293 cells after exposure to OV420 secreted, DiD labeled (red) exosomes. 40x magnification was utilized to image HEK293 cells following exosome exposure using confocal microscopy.
To determine if uptake of IGROV1 or OV420 cell-secreted exosomes leads to changes in cell phenotype or behavior, HEK293 cells were incubated with exosomes and invasion and migration assays were conducted. Uptake of IGROV1 cell-secreted exosomes leads to significant increase in invasion as well as migration as early as 12 hours in HEK293 cells, compared to HEK293 cells incubated in media with vehicle or supernatant (Figures
Invasion of HEK293 cells exposed to IGROV1 or OV420 cell-secreted exosomes. (a) HEK293 cells invasion when exposed to IGROV1 cell-secreted exosomes and (b) HEK293 cells invasion when exposed to OV420 cell-secreted exosomes. Asterisk indicates a
Migration of HEK293 cells exposed to IGROV1 or OV420 cell-secreted exosomes. (a) HEK293 cells migration when exposed to IGROV1 cell-secreted exosomes and (b) HEK293 cells migration when exposed to OV420 cell-secreted exosomes. Asterisk indicates a
HEK293 exposure to and uptake by IGROV1 cell-secreted exosomes leads to invasion and migration; therefore, qPCR analysis was performed using Human Epithelial-to-Mesenchymal Transition RT2 Profiler PCR arrays to determine changes in relative expression of 84 genes known to be involved in EMT. Exposure to exosomes resulted in significant increased levels of 45 EMT-related genes, including
Epithelial-to-Mesenchymal Transition (EMT) related genes that are significantly upregulated after HEK293 cells exposed to IGROV1 cell-secreted exosomes.
Fold change | Genes |
---|---|
25.65 |
|
10.95 |
|
10.55 |
|
9.67 |
|
8.32 |
|
7.37 |
|
7.33 |
|
7.13 |
|
6.58 |
|
6.49 |
|
6.45 |
|
6.41 |
|
6.38 |
|
6.35 |
|
6.32 |
|
6.04 |
|
5.7 |
|
5.53 |
|
5.39 |
|
5.35 |
|
5.32 |
|
5.24 |
|
5.2 |
|
5.15 |
|
5.13 |
|
4.82 |
|
4.78 |
|
4.49 |
|
4.29 |
|
4.28 |
|
4.19 |
|
4.14 |
|
4.12 |
|
4.09 |
|
4 |
|
3.95 |
|
3.86 |
|
3.82 |
|
3.81 |
|
3.8 |
|
3.37 |
|
3.25 |
|
3.22 |
|
3.09 |
|
3.03 |
|
In addition to EMT-related genes, relative changes in LIN28A, LIN28B, and selected miRNAs known to be involved in EMT and cancer (oncomirs) were assessed in HEK293 cells following uptake of IGROV1 cell-secreted exosomes. Taqman qPCR assays revealed that there was a significant, 15-fold increase in
Relative levels of LIN28A and LIN28B mRNA and protein in HEK293 cells exposed to IGROV1 cell-secreted exosomes. HEK293 cells treated with vesicle-deplete IGROV1 conditioned media (vehicle), HEK293 cells treated with supernatant from exosome pellet (supernatant), and HEK293 cells treated with exosomes (exosome transfer). qPCR was performed to assess mRNA levels of
Relative level of
Relative level of selected miRNAs in HEK293 cells following IGROV1 cell-secreted exosome treatment. qPCR was utilized to determine the relative levels and data were normalized against U6 snRNA. Asterisks indicate a
Using Western blot analysis, exosomes secreted by IGROV1, OV420, and HEK293 cells were all positive for exosomal protein markers TSG101 and EPCAM; however, neither LIN28A nor LIN28B was detected in IGROV1, OV420, or HEK293 cell-secreted exosomes (Figure
Detection of LIN28A and LIN28B protein in exosomes. Western blot was used to determine the presence of LIN28A protein in exosomes (columns 3–5). The cytoplasmic/mitochondrial protein cytochrome C (CYTO C) was used as a negative control to exclude nonexosomal fractions, and tumor susceptibility gene 101 (TSG101), a component of the endosomal sorting, and EPCAM (epithelial cell adhesion molecule) are used as positive controls for exosomes.
Relative levels of selected miRNAs in ovarian cancer cell-secreted exosomes. qPCR data were normalized against U6 snRNA. Means without the same superscript are significantly different (
Relative levels of
In this study we sought to determine if exosomes from high LIN28A expressing ovarian cancer cells could be taken up by HEK293 cells leading to changes in gene expression and cell phenotype. IGROV1 cells contain high levels of LIN28A mRNA and protein and low levels of
Previous studies demonstrate that tumor secreted microvesicles/exosomes can alter target cell gene expression and cell behavior. For example, glioblastoma tumor cell-secreted exosomes in the brain are enriched with angiogenic proteins and can be taken up by brain microvascular endothelial cells to stimulate tubal formation [
LIN28 is a RNA-binding protein that binds to and regulates both mRNAs and miRNAs. LIN28A and miRNAs can reprogram cells and are known regulators of cell differentiation, and studies have demonstrated deregulation of miRNAs in cancer [
We also determined that
The
Taken together, data presented here demonstrate that high LIN28A expressing ovarian cancer cells secrete exosomes that, when taken up by nonmetastatic target cells, induce EMT-related gene expression and invasion and migration.
Our results demonstrate that the more metastatic, high LIN28A expressing IGROV1 cells secrete exosomes that can upregulate genes related to EMT and induce invasion and migration in HEK293 cells. We were unable to demonstrate presence in or transfer of LIN28 itself by exosomes, and it is possible that the observed changes in cell phenotype and gene expression induced by IGROV1 cell-secreted exosomes are not due to LIN28 directly. Future studies using different high LIN28A expressing cancer cells will be important to determine if the observed features of IGROV1 cell-secreted exosomes hold true for other high LIN28A-expressing cells. Although a number of known cancer and EMT-related miRNAs were investigated, only miR-9 was altered in HEK293 cells following IGROV1 cell-secreted exosome treatment. The fact that LIN28 can interact with and bind to many RNAs in addition to miRNAs suggests additional RNAs are potential candidates that can be loaded into exosomes and/or transferred to target cells. Future RNAseq experiments will provide insight into the underlying mechanism of the observed exosome-induced invasion and migration.
The authors declare that there is no conflict of interests regarding the publication of this paper.
The authors would like to thank Dr. Russell V. Anthony at Colorado State University for providing them with the human embryonic kidney cell line (HEK293) and the Animal Reproduction and Biotechnology Laboratory at Colorado University for use of their facility. They would also like to thank Dr. Douglas Thamm at the Flint Animal Cancer Center at Colorado State University for allowing them to utilize their equipment and incubators for the invasion and migration assays. They are extremely thankful for the training Barbara Rose provided to perform the invasion and migration assays. Funding for this project was provided by American Cancer Society Institutional Research Grant no. 57-001-50 and Colorado State University Cancer Supercluster Grants 2011 and 2014.