Oral squamous cell carcinoma (OSCC), the most frequent of all oral cancers, is a type of highly malignant tumors with a high capacity to invade locally and form distant metastases. An increasing number of studies have shown that microRNAs (miRNAs) play an important role in regulating cancer metastasis and invasion. In the present study, we detected the expression of miR-221 in two highly metastatic OSCC cell lines and two OSCC cell lines that are less metastatic using quantitative real-time PCR analysis (qRT-PCR). The qRT-PCR results indicate that miR-221 is upregulated in highly metastatic OSCC cell lines. Then, miR-221 expression was knocked down by transfection with miR-221 inhibitor, and UM1 cell migration and invasion were assessed using transwell migration and invasion assays. The results indicate that inhibition of miR-221 suppressed migration and invasion of UM1 cells. Furthermore, methyl-CpG binding domain protein 2 (MBD2) was identified as a direct target gene of miR-221. Additionally, MBD2 silencing could partly reverse the effect of miR-221 on cell migration and invasion. In conclusion, downregulation of miR-221 inhibits cell migration and invasion at least partially through targeting MBD2 in the human OSCC cell line UM1.
Oral cancer, a type of head and neck cancer, is any cancerous tissue growth located in the oral cavity. Oral cancer has been identified as a significant worldwide public health threat because its treatment often produces dysfunction and distortions in speech, mastication and swallowing, dental health, and even the ability to interact socially [
MicroRNAs (miRNAs) are small noncoding RNA molecules (containing approximately 22 nucleotides) that function in RNA silencing and posttranscriptional regulation of gene expression through binding to the 3′-untranslated region (UTR) of target genes [
The exact function of miR-221 in cancer metastasis and invasion of OSCC remains unclear. In this study, we focused on demonstrating the function of miR-221 in OSCC metastasis and invasion, and we identified the target of miR-221 related to metastasis and invasion. The present study revealed that miR-221 is upregulated in highly metastatic OSCC cell lines and that downregulation of miR-221 inhibits cell migration and invasion partly through targeting methyl-CpG binding domain protein 2 (MBD2).
The OSCC lines CAL-27, Tca8113, UM1, and UM2 [
A negative control (miR-NC), miR-221 mimic, and miR-221 inhibitor were purchased from Jima Biotech (Suzhou, China). miR-221 inhibitor is chemically modified antisense oligonucleotide, which can compete against endogenous miRNAs in RNA-induced silencing complex incorporation. A small interfering RNA against MBD2 (si-MBD2) and a negative control (si-NC) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Cells were plated at 50% confluence and transfected with 300 nM miR-221 mimic or 10
Total RNA was extracted from harvested cells using Trizol reagent (Invitrogen, CA, USA). To analyze miR-221 expression, reverse transcription PCR was performed using specific stem-loop reverse transcription primers, miRNA first strand synthesis was performed using a First Strand Synthesis Kit (Takara, Dalian, China), and qRT-PCR was performed using a Mir-X miRNA qRT-PCR SYBR Kit (Takara, Dalian, China) on an Applied Biosystems 7500 system (Applied Biosystems, Warrington, UK). U6 was used as an internal control.
To quantify mRNA levels of MBD2, reverse transcription PCR was performed using PrimeScript RT Reagent Kit with cDNA Eraser (Takara, Dalian, China), and qRT-PCR was performed using SYBR Premix Ex Taq (Takara, Dalian, China). GAPDH was used as an internal control. The primer sequences used in qRT-PCR are shown in Table
Primers for qRT-PCR.
Primer name | Sequence (5′-3′) |
---|---|
miR-miR-221 | AGCTACATTGTCTGCTGGGTTTC |
miR-miR-221 RT | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGAAACCCA |
miR-miR-221 F | ACACTCCAGCTGGGAGCTACATTGTC |
U6 F | CTCGCTTCGGCAGCACA |
U6 R | AACGCTTCACGAATTTGCGT |
Universal R | CTCAACTGGTGTCGTGGA |
MBD2 F | AGACCCACAACGAATGAATGAAC |
MBD2 R | CTGGACAACTCCTTGAAGACC |
GAPDH-F | ACACCCACTCCTCCACCTTT |
GAPDH-R | TTACTCCTTGGAGGCCATGT |
F: forward primer, R: reverse primer, and RT: reverse transcription primer.
Cell migration and invasion were assessed using a transwell assay. For migration, UM1 cells were harvested and 5 × 104 cells in 200
For studying cell migration in a scratch wound assay, UM1 cells were seeded in 6-well plates and artificial wounds were inflicted to the cell layer by scratching with sterile 200
Each group of UM1 cells was lysed using RIPA buffer (Beyotime Biotechnology, Nantong, China). The total protein concentration was determined using a BCA Protein Assay kit (Beyotime Biotechnology, Nantong, China). Equal amounts of total protein were loaded in tracks, separated on 8% SDS polyacrylamide gels, and transferred to PVDF membranes (Pall, New York, NY, USA). Membranes were blocked for 1 h at room temperature with 5% milk in TBS containing 0.05% Tween-20 (TBST), incubated for 1 h with rabbit anti-human MBD2 monoclonal antibody (1 : 5000, ab109260, Abcam, Cambridge, MA, USA) or rabbit anti-human beta actin monoclonal antibody (1 : 2000, ab119716, Abcam, Cambridge, MA, USA), and washed three times with TBST. Membranes were incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG H&L secondary antibody (1 : 10000, ab97080, Abcam, Cambridge, MA, USA) for 40 min and washed three times with TBST, and proteins were visualized using ECL (Thermo Scientific Pierce ECL Plus).
The miRNA target prediction software programs Targetscan (
Primers for luciferase reporter construction.
Primer name | Sequence (5′-3′) |
---|---|
psiCHECK2-XhoI-F | CCGctcgagGAATATGATCAGGTAACTTTCGACCG |
psiCHECK2-NotI-R | ATAAGAATgcggccgc ACTCCCTCCCTTCCTTGGTATCAG |
psiCHECK2-mut-F | GCCAGGTGCAATCTACTGGAAATACCTCACTTACGTAAAACATTTGTTTCC |
psiCHECK2-mut-R |
|
F: forward primer and R: reverse primer.
All statistical analyses were performed using SPSS 19.0 software (IBM, Chicago, IL, USA). Results are represented as means ± standard deviation (SD). Student’s
To investigate the role of miR-221 in regulating OSCC cell migration and invasion, we detected the miR-221 expression level in two highly metastatic OSCC cell lines (CAL-27 [
miR-221 is upregulated in highly metastatic OSCC cell lines. The expression level of miR-221 in two highly metastatic OSCC cell lines (CAL-27 and UM1) and two less metastatic OSCC cell lines (Tca8113 and UM2) was detected using qRT-PCR. The results are presented as means ± SD.
Since the expression level of miR-221 is increased in the highly metastatic OSCC cell line UM1, we transfected a miR-221 inhibitor into UM1 cells. Then, cells were harvested for qRT-PCR. The results indicate that the miR-221 inhibitor could effectively suppress miR-221 expression (Figure
The expression level of miR-221 after miR-221 inhibitor transfection for 48 h detected using qRT-PCR. Results are presented as means ± SD.
To demonstrate the role of miR-221 in regulating UM1 cell migration and invasion, transwell and wound healing assays were performed after miR-221 inhibitor or miR-NC transfection. For transwell migration assays, the number of cells that passed through the membrane onto the lower chamber was significantly less in the miR-221 inhibitor transfected cells than in miR-NC transfected cells (Figure
Inhibition of miR-221 suppressed migration and invasion of UM1 cells. (a) Representative images of UM1 cell migration are shown. The migration of UM1 cells was measured using a transwell assay at 48 h after transfection with miR-221 inhibitor or miR-NC. (b) The average number of migrating cells per field for the indicated experimental groups is shown. (c) Representative images of UM1 migration cells analyzed by wound healing assays. Images show migration of cells after 0 h and 24 h. (d) Quantification of migrated UM1 cells analyzed by wound healing assays. The migration of UM1 cells transfected with miR-NC set to 100%. (e) Representative images of UM1 cell invasion are shown. The invasion of UM1 cells was measured using a Matrigel invasion assay at 48 h after transfection with miR-221 inhibitor or miR-NC. (f) The average number of invading cells per field for the indicated experimental groups is shown. Data are presented as means ± SD.
To elucidate the underlying mechanism by which miR-221 suppresses migration and invasion of UM1 cells, we explored miR-221 targets using the Targetscan and miRanda bioinformatics algorithms. Our analysis revealed that MBD2 was a potential target of miR-221 based on a putative conserved target sequence at position 291–298 of the MBD2 3′-UTR (Figure
MBD2 is a direct target of miR-221. (a) Predicted duplex formation between the wild-type or mutant MBD2 3′-UTR and miR-221. (b) Western blot showing MBD2 protein expression level in OSCC cell lines. Actin was used as an internal loading control. (c) Luciferase activity of wild-type (3′-UTR-wild) or mutant (3′-UTR-mutant) MBD2 3′-UTR-containing reporters in UM1 cells transfected with miR-221 mimic or miR-NC. (d) qRT-PCR of MBD2 mRNA in UM1 cells transfected with miR-221 mimic or miR-NC. Data were normalized to GAPDH mRNA. Data are expressed as mean ± SD;
To examine whether miR-221 affects UM1 migration and invasion through MBD2, UM1 cells were transfected with si-MBD2. As shown in Figures
The effect of MBD2 silencing on cell migration and invasion of UM1 cells after miR-221 transfection. (a) MBD2 mRNA expression 48 h after transfection with si-MBD2 or si-NC. (b) Western blot of MBD2 protein expression 48 h after transfection with si-MBD2 or si-NC. (c) Representative images of UM1 cell migration are shown. The migration of UM1 cells was measured using a transwell assay at 48 h after the transfection of miR-221 inhibitor plus si-NC or miR-221 inhibitor mimic plus si-MBD2. (d) The average number of migrating cells per field among the indicated experimental groups is shown. (c) Representative images of UM1 migration cells analyzed by wound healing assays. Images show migration of cells after 0 h and 24 h. (d) Quantification of migrated UM1 cells analyzed by wound healing assays. The migration of UM1 cells transfected with miR-221 inhibitor mimic plus si-NC set to 100%. (g) Representative images of UM1 invasion are shown. The invasion of UM1 cells was measured using a Matrigel invasion assay at 48 h after the transfection of miR-221 inhibitor mimic plus si-NC or miR-221 inhibitor mimic plus si-MBD2. (h) The average number of invading cells per field for the indicated experimental groups is shown. Data are presented as means ± SD.
MiRNAs have been shown to play a dual role in tumor invasion and metastasis [
miRNAs function by regulating the expression of target genes by either inducing mRNA degradation or inhibiting mRNA translation through imperfect base-pairing with the 3′-UTR of target mRNAs [
MBD2 belongs to a family of MBD domain containing proteins, including MBD1, MBD2, MBD3, MBD4, and MeCP2, which associate with heterochromatin in the nucleus through an interaction with methylated DNA at CpG islands [
In conclusion, we determined that miR-221 is highly expressed in highly metastatic OSCC cell lines, and downregulation of miR-221 inhibits cell migration and invasion partly through targeting MBD2 in the human OSCC cell line UM1.
The authors have no conflict of interests pertaining to this paper.
This study was supported by Science and Technology Planning Project of Guangdong Province, China (2011B080701014).