Metformin, a popular drug used to treat diabetes, has recently gained attention as a potentially useful therapeutic agent for treating cancer. In our research metformin was added to
Metformin is a common drug used worldwide in the treatment of diabetes mellitus. It belongs to the group of biguanidine drugs, among which it has the best safety profile [
Metformin is also assigned to the conceptual group of drugs, known as calorie restriction mimetics (CRM). It has been demonstrated that calorie restriction is a very effective way of increasing the lifespan by reducing morbidity and mortality in mice with tumors [
Bone marrow provides a niche for various populations of stem cells, the interplay of which is essential for body homeostasis. Biology of the bone marrow-derived multipotent mesenchymal stromal cells (BMSCs) is continuously being studied. Their potential for self-renewal as well as high phenotypic plasticity, manifested by the ability to differentiate into bone, cartilage, or adipose tissue, is extremely important in terms of regenerative medicine [
The properties of self-renewal and differentiation of stem cells might be regulated by octamer-binding protein 4 (Oct-4), a transcription factor crucial for embryonic development [
We have investigated the effect of metformin in cell cultures at doses cytotoxic for cancer cells [
All reagents used in this experiment were purchased from Sigma-Aldrich (Poland), unless indicated otherwise.
The study was conducted with the approval of the Bioethics Committee, as stated by the Second Local Bioethics Committee at the Department of Biology and Animal Breeding, Wroclaw University of Environmental and Life Sciences, Wroclaw, Chelmonskiego 38C, Poland (Dec. number 177/2010 of 11.15.2010).
Two types of mouse cells were used in the experiments: multipotent stromal cells (BMSCs) derived from bone marrow (primary cultures) and Balb/3T3 embryonic fibroblasts (cell line obtained from the Institute of Immunology and Experimental Therapy, Polish Academy of Sciences).
Bone marrow-derived multipotent mesenchymal stromal cells (BMSCs) were isolated from twelve 4-week-old C57BL/6 mice (Animal Vivarium Wroclaw Medical School, Poland). Femurs were collected directly after euthanasia of the animal and placed in a sterile Hanks’ balanced salt solution (HBSS). Cells were isolated from the bone marrow by flushing with an insulin syringe U-40 (29G X 1/2′′ needle) filled with HBSS. Cell suspension was transferred into falcon tube and centrifuged at 300
Bone marrow cell suspensions, isolated by flushing femurs and tibia, were lysed in BD lysing buffer (BD Biosciences, San Jose, CA, USA) for 15 min at room temperature and washed twice in phosphate-buffered saline (PBS). The cells were subsequently stained for Sca-1 antigen and hematopoietic lineage markers (Lin) for 30 min in medium containing 2% foetal bovine serum. The following anti-mouse antibodies (BD Pharmingen) were used for staining: Sca-1 (FITC, clone D7), B220 (PE, clone RA3-6B2), T-cell receptor-
To phenotype BMSC cell surface antigens, Sca-1+/Lin− cells were stained using the following: CD31 (APC, clone 390), CD45 (APC-Cy7, clone 30-F11), CD51 (biotin, clone RMV-7 with streptavidin conjugated to PE-Cy5), CD73 (FITC, clone B5), CD90 (PB, clone 53-2.1), and CD105 (PE, MJ7/18). All monoclonal antibodies (mAbs) were added at saturating concentrations and the cells were incubated for 30 minutes on ice, washed twice, resuspended in staining buffer at a concentration of
Adipogenic and osteogenic differentiation of BMSCs was induced using commercial kits (StemPro, Life Technologies). Stimulation toward adipocytes lasted 14 days, while osteogenesis was induced during a 21-day period. To evaluate adipogenic and osteogenic differentiation, two specific staining methods were used, that is, Oil-Red O for the detection of neutral lipid deposits and Alizarin red for calcium deposits. Preparations were analyzed using an Axio Observer A1 inverted microscope (Carl Zeiss, Jena, Germany). Documentation was made using Canon PowerShot camera.
Cultures were maintained at 37°C in a humidified atmosphere of 5% CO2 and 95% air. Primary and subsequent cultures of BMSCs were propagated in Dulbecco’s Modified Eagle’s Medium (DMEM) with Ham’s F-12 nutrient mixture, while Balb/3T3 were maintained in DMEM containing 4500 mg/L of glucose. All culture media were supplemented with 10% of FBS and 1% of antibiotics (penicillin and streptomycin). Medium was changed every two days. The passage of cells was performed at 80–90% confluence. Prior to the experiment, the cells were passaged three times using trypsin solution (TrypLE; Life Technologies) according to the manufacturers’ instruction.
Metformin (Metformax 850; Teva Pharmaceuticals, Poland) was grinded with a mortar and dissolved in the culture medium at the following concentrations: 1 mM, 5 mM, and 10 mM. Nontreated cells served as a control for comparison with the test cultures. For the analysis of proliferation, morphology, ultrastructure, and gene expression both BMSCs and Balb/3T3 were inoculated into 24-well plates, while measurements of DNA synthesis were performed in cultures propagated in 96-well plates. Initial concentration of cells in 24-well dishes was
Cell viability was evaluated after 24, 48, and 72 hours using resazurin-resorufin system. To perform the assay, medium was removed and replaced with a medium containing 10% of the dye. Cells were incubated in a CO2 incubator for 2 hours and then the supernatants were collected and transferred into the 96-well microplate reader (Spectrostar Nano, BMG Labtech). Supernatants after BMSCs and Balb/3T3 cultures were derived from three independent experiments. The absorbance of the supernatants was measured spectrophotometrically at a wavelength of 600 nm for resazurin and 690 nm as a reference wavelength. Each test included a blank containing complete medium without cells.
DNA synthesis was assessed by measuring the incorporation of 5-bromo-2-deoxyuridine (BrdU) into cellular DNA. Proliferation of cells was analyzed three times independently after 24, 48, and 72 hours of the experiment. The assay was carried out using BrdU Cell Proliferation ELISA Kit, based on the protocol provided by the manufacturer (Abcam). Briefly, cultures were treated with BrdU and incubated overnight at 37°C in a humidified atmosphere. After incubation with BrdU, cells were fixed and DNA was denatured using a Fixing Solution provided by the manufacturer. BrdU incorporation was detected using anti-BrdU monoclonal antibody. Incubation of cells with specific antibody was performed at room temperature and lasted for 1 hour. Goat anti-mouse IgG conjugated with horseradish peroxidase (HRP) was used as secondary antibody. Incubation with secondary antibody was performed at room temperature for 30 minutes. Color reaction was developed using 3,3′,5,5′-tetramethylbenzidine (TMB) as substrate and stopped after 30 minutes. Incubation with substrate was performed at room temperature, avoiding exposition to excessive light. Signal intensity was measured with a spectrophotometer microplate reader (Spectrostar Nano, BMG Labtech) at a wavelength of 450/550 nm.
The morphology of the studied cells was evaluated with an epifluorescent microscope (Zeiss, Axio Observer A.1) and scanning electron microscope (SEM, Zeiss Evo LS 15). The analysis of morphology was performed after 48 h of the experimental culture in 24-well plates. Preparation of cells for fluorescence microscopy was as follows: cells were (i) washed three times using HBSS, 1 minute each wash; (ii) fixed in 4% ice cold paraformaldehyde, overnight at 4°C; (iii) washed (as described above); (iv) permeabilized for 15 minutes with 0.1% Triton X-100, at room temperature; (v) washed (as described above); (vi) stained with atto-488-labeled phalloidin (1 : 800) for 30 minutes in the dark at room temperature; and (vii) counterstained using diamidino-2-phenylindole (DAPI; 1 : 1000), for 5 minutes at room temperature as described previously [
Ultrastructure analysis of cells was performed by using a scanning transmission electron microscope (TEM, Zeiss Evo LS 15) as described previously [
Cells were rinsed twice using HBSS after 48 h culture and then homogenized using 0.8 mL of TRI Reagent. Total RNA was isolated according to a single-step method described by Chomczynski and Sacchi [
Sequences of primers used in qPCR.
Gene | Abbreviation | Sequence 5′-3′ | Loci | Amplicon length [bp] | Accession number |
---|---|---|---|---|---|
Beta-2 microglobulin | b2m | F: CATACGCCTGCAGAGTTAAGCA | 341–362 | 73 | NM_009735.3 |
R: GATCACATGTCTCGATCCCAGTAG | 413–390 | ||||
|
|||||
Insulin-like growth factor 2 | IGF2 | F: TCAGTTTGTCTGTTCGGACCG | 223–243 | 223 | NM_001122737.1 |
R: TTGGAAGAACTTGCCCACG | 445–427 | ||||
|
|||||
Insulin-like growth factor 2 receptor | IGF2R | F: GGCTGCGATCGATATGCATCT | 2616–2636 | 106 | NM_010515.2 |
R: GGCCTATCTTTGCAACTCCCA | 2721–2701 | ||||
|
|||||
H19 | H19 | F: AGGTGAAGCTGAAAG | 2031–2045 | 97 | NR_001592.1 |
R: GCAGAGTTGGCCATGAAGATG | 2127–2107 | ||||
|
|||||
Octamer binding transcription factor 4 | Oct-4 | F: TTCTGCGGAGGGATGGCATA | 258–277 | 232 | NT_039649.8 |
R: GTTCTAGCTCCTTCTGCAGGG | 489–469 |
The supernatants of the cultures were analyzed by ELISA to determine the concentration of secreted IGF2. Supernatants were collected after 48 hours of cell propagation from control and experimental cultures. Aliquots were kept at −20°C until ELISA analysis. Marker protein was assayed using specific mouse IGF-II ELISA kit (DuoSet ELISA Development kit; R&D Systems, Poland). Before each assay, all samples were briefly centrifuged and twofold diluted. The substrate for peroxidase used in ELISA was 3,3′,5,5′-tetramethylbenzidine (TMB), and the reaction was stopped with 2 N sulfuric acid (H2SO4). Readouts were conducted at a wavelength of 450 nm using a spectrophotometer (BMG Labtech).
Normality of the population data was determined using the Shapiro-Wilk test, while equality of variances was assessed by Levene’s test. Differences between groups were determined using one- or two-way analysis of variance (ANOVA). Statistical analysis was performed with STATISTICA 10.0 software (StatSoft, Inc., Statistica for Windows, Tulsa, OK, USA). Differences with a probability of
The analysis showed that BMSCs, isolated according to the method described, expressed markers specific for multipotent mesenchymal stromal cells, that is, CD51, CD73, CD90, and CD105. Cells were negative for hematopoietic marker, that is, CD45 and endothelial marker CD31. (Figure
Characterization of BMSC phenotype and determination their multipotency. Phenotype of BMSCs was determined by flow cytometry. The analysis revealed that BMSCs isolated by the described method were negative for CD45 and CD31. In addition, the cells were strongly positive for CD51, CD73, CD90, and CD105 (panel (a)). Morphology of BMSC culture in standard (b), adipogenic (c), and osteogenic conditions (d). Specific stainings were carried out to determine the BMSC differentiation to adipocytes and osteocytes. Oil-Red O staining was used to detect lipid droplet formation during adipogenic differentiation (c). Alizarin red staining was used to detect calcium deposition during osteogenic differentiation (d). Images of differentiated cultures were captured at 100x magnification (scale bar = 200
Cellular proliferative activity of both of BMSCs as well as mouse embryonic fibroblast cell line Balb/3T3 was evaluated after 24, 48, and 72 hours of culture (Figures
Influence of metformin on the proliferative activity of BMSCs (a) and mouse embryonic fibroblast cell line Balb/3T3 (b). Proliferation of control cultures was compared to the cultures propagated with metformin. (a) No difference in the proliferation rate of BMSCs was recorded after 24 and 48 hours (
Results of BrdU incorporation assay. (a) Cytotoxic effect of 10 mM metformin was recorded starting from 24th hour of BMSC culture. Metformin at 5 mM concentration significantly reduced DNA synthesis in BMSC cultures after 72 hours of treatment. Metformin at the lowest investigated concentration did not affect DNA synthesis. (b) Increase of DNA synthesis was observed in Balb/3T3 after 48 hours of culture with 1 mM metformin. Cytotoxic effect of metformin was prominent after 72 hours of culture, especially when Balb/3T3 were treated with metformin at 5 and 10 mM doses. Fold change in DNA synthesis was calculated by comparing BrdU signals of metformin-treated cells to that of the control culture, to which a value of 1 was assigned. An asterisk (
After 24 hours of propagation, no significant changes were observed in the proliferation of Balb/3T3 in control and experimental culture. However, 48-hour metformin exposure of Balb/3T3 cultures negatively influenced metabolic activity of cells. Interestingly, in Balb/3T3 culture metformin at 1 mM and 5 mM concentrations exerted comparable effects on the cell proliferation. Growth curves of these cultures had similar patterns, indicating culture restoration and increase of cell proliferative activity after 72 hours. Similarly as in BMSC cultures, the activity of cells was significantly reduced after exposure to 10 mM metformin (Figure
Evaluation of morphological changes was performed after 48-hour propagation based on the results of cytotoxic assay (Figure
Morphology of murine BMSCs (left column) and Balb 3T3 (right column) in the control and experimental cultures. Three distinct cell types of BMSCs are indicated with white arrows: large flat cells (thick arrows), smaller fibroblast-like cells (arrows with dotted shaft), and small round cells (thin arrows). Morphotypes of Balb/3T3 cells are indicated with yellow arrows: large multinucleated cells (thick arrows), fibroblast-shaped cells (thin arrows), and small round cells (arrows with dotted shafts). Cytoskeleton was stained using atto-488 phalloidin; therefore, cellular bodies are stained in green. Nuclei stained with DAPI are visible as white dots, while dead cells visualized in the reaction with propidium iodide are stained in red. Magnification 100x, scale bar = 200
Control culture of murine BMSCs was characterized by heterogeneous morphology. Three distinct cell types were present: population of fibroblast-like cells, with the predominance of bi- or multipolar cells, the most apparent large flat cells of irregular shape, and small cells adhering to the surface of large cells. Cytoskeleton of smaller fibroblast cells and large flat cells was well developed and nuclei were centrally localized, while the cytoskeleton of small cells was less developed, forming a thin rim around the oval nuclei. Moreover, small cells had characteristic actin projections on the edge of the cell body—lamellipodia. Small cells were more numerous in BMSC culture treated with metformin at a concentration of 1 mM, even though both fibroblast-like and large cells were still prevalent. No signs of cytoskeleton deformation or nuclei degradation were observed. Moreover, the confluence of culture treated with 1 mM metformin was similar to the control culture. The amount of dead cells visualized with propidium iodide was increasing with the metformin dose, as shown by quantitative analysis (Figure
The percentage of dead cells quantified after propidium iodide staining. Calculation was performed based on the images obtained from three independent experiments. Evaluation of cell viability in cultures after 48 h of treatment with 1 mM, 5 mM, and 10 mM metformin. The number of dead cells in BMSC cultures (a) and Balb/3T3 cultures (b) increased after treatment with metformin at 5 and 10 mM concentration. Statistical analysis was performed in relation to the results obtained for control culture (no metformin). An asterisk (*) indicates a statistically significant difference (
Additionally, SEM analysis showed that the cells from cultures propagated in the presence of 1 mM metformin developed numerous thin cytoskeletal projections (filopodia) and secreted many microvesicles, similarly to the cells of the control culture (Figure
SEM analysis of cellular membrane projections. Images were captured at magnification 5000-fold, scale bar = 2
Although small, oval or spindle-shaped cells were characteristic for the control culture of Balb/3T3 fibroblasts, enlarged and multinuclear cells were also present. The cytoskeleton of Balb/3T3 cells was well developed in the case of cells with a typical fibroblast morphotype or large cell body. Cytoplasmic organelles of oval-shaped cells were limited to the rim around nuclei. No signs of apoptosis were observed. The pattern of growth of 3T3/control culture was random, cells formed aggregates, next to densely and evenly arranged areas of culture. The introduction of metformin to 3T3/Balb culture at a concentration of 1 mM and 5 mM had no significant effect on the pattern of growth and morphology of cells; nevertheless, a decrease in the number of large multinuclear cells was visible. Furthermore, evaluation of cell surface showed that the cells from cultures with 1 mM and 5 mM metformin had well developed filopodia and lamellipodia. Cytotoxic effect of metformin at 10 mM concentration was apparent when cell morphology was evaluated. Cell bodies were significantly reduced and cellular debris was dominant in the image. SEM analysis showed lack of cellular projections and shrunken cell bodies.
Transmission electron microscopy revealed changes in the structure and arrangement of organelles after treatment with metformin (Figure
Ultrastructure of BMSCs and Balb/3T3 cells of control and experimental cultures. Scale bar = 2
BMSCs treated with 1 mM metformin had a better developed rough reticulum when compared to the control culture. Golgi apparatus was also more apparent. The number of endosomes and peroxisomes in BMSCs treated with 1 mM concentration was comparable to the control culture, but microvesicles were more abundant. The ultrastructural analysis of BMSCs cultured with 5 mM concentration of the drug showed an increase in the number of late endosomes and lysosomes. Long cellular projections were also characteristic of BMSCs cultured in 5 mM metformin, but microvesicles were observed sporadically. BMSCs treated with 10 mM metformin had an irregular shape, and the cytoplasm was filled with vacuoles. The initial stage of apoptotic body formation was also recorded.
A distinctive feature of Balb/3T3 cells cultured with 1 mM metformin was a ridged cellular membrane releasing microvesicles and exosomes. The addition of metformin at a concentration of 5 mM resulted in enhanced production of endosomes and peroxisomes, while the release of microvesicles was reduced. Complete damage of Balb/3T3 cells was recorded in the culture with 10 mM metformin. Microscope imaging showed only fragmented nuclei and small apoptotic bodies.
The next stage of the study was to determine the expression of genes associated with proliferative potential of cells. Consequently, the analysis was performed on cells derived from cultures propagated for 48 hours. Quantitative analysis of transcripts revealed that the expression of H19 and IGF2 in BMSCs was not altered in the experimental cultures. The level of IGF2R transcript in BMSCs was constant in cultures with 1 mM and 5 mM metformin but decreased in the cultures with 10 mM concentration. In turn, the expression of Oct-4 gene was increased in BMSC cultures propagated with 10 mM metformin, while the transcript level in cultures with 1 mM and 5 mM metformin was not changed when compared to the control culture (Figure
mRNA expression of H19, insulin-like growth factor 2 (IGF2), its receptor (IGF2R), and Oct-4 in BMSCs (a) and Balb/3T3 cell line (b) in control and experimental cultures. The level of expression of all genes was calculated in relation to the housekeeping gene, beta 2 microglobulin (
The expression of H19 gene in Balb/3T3 cells was reduced in cultures treated with metformin; however, significant changes in transcript level, compared to the control culture, were observed only when cells were treated with 5 and 10 mM metformin. The investigated concentrations of metformin did not influence the amount of IGF2 transcript in Balb/3T3 cells; in turn, lower level of IGF2R mRNA was observed when compared to the control culture. The level of Oct-4 transcript was significantly decreased in cultures treated with 5 and 10 mM metformin (Figure
Quantitative analysis of IGF2 concentration showed that the propagation of BMSCs with 5 mM and 10 mM metformin decreased the level of this protein. Different patterns were observed for Balb/3T3, where an increase of metformin level was positively correlated with the concentration of IGF2 protein (Figure
Quantitative analysis of IGF2 protein level in the supernatants after BMSC (a) and Balb/3T3 (b) cultures. Statistically significant differences were observed at
Currently, metformin is perceived not only as a hypoglycemic agent but also as a comprehensive medication. The administration, among many others, is recommended in medical conditions associated with metabolic disorders. However, the greatest expectations are held with the application of metformin in the treatment of cancer and activation of endogenous adult stem cells [
In this study, we decided to analyze the effect of metformin on the proliferative activity, morphology, and ultrastructure of two populations of cells: (i) primary cultures of bone marrow-derived multipotent mesenchymal stromal stem cells and (ii) well established fibroblast Balb/3T3 cell line. As opposed to the committed cells (here fibroblasts), mesenchymal stem cells possess the unique ability to self-renew and to differentiate into other cells of mesodermal lineages [
Antitumor effect of metformin was established for doses from 5 to 30 mM [
The effect of metformin on BMSCs has been investigated by Gao et al. [
The influence of metformin on physiology of BMSCs and fibroblasts has been thus far predominantly studied in the context of their proliferation [
Decrease in cell proliferation can be associated with cytotoxic effect of metformin, which has been previously observed in various cancer cell lines [
Undeniably, significant part of our experimental model was focused on the evaluation of morphological and ultrastructural changes of cells after metformin treatment. We argue that the analysis of cellular organization should be a key parameter when determining the effects of active agents, such as metformin, even though the evaluation of cell proliferation and gene expression becomes an important complement to such analysis. Detailed investigation of cell morphology is often neglected, due to the difficult and time-consuming techniques or is sometimes reduced to the analysis of cell shapes and growth patterns with an inverted light or fluorescence microscope, as in the papers discussed [
Morphology is an important large-scale manifestation of the global organizational and physiological state of the cells [
Epifluorescence microscopy in BMSC control culture revealed the occurrence of three distinct morphotypes. Our observation corresponds with findings presented by Ren et al. [
Analysis of gene expression of the components of IGF2 signaling pathway showed that the expression of IGF2 gene was not affected by metformin treatment neither in BMSC nor Balb/3T3 cell line. The expression of H19 in BMSCs demonstrated that metformin did not influence the level of mRNA. What is more, the level of H19 transcript was comparable with IGF2 mRNA level, which contributes to maintaining the proliferation balance [
Synthesis of IGF2 mRNA seems to be functioning in a constitutive manner. IGF2 is strongly involved in cell proliferation, survival, and migration [
In summary, metformin introduced to BMSC and Balb/3T3 cultures at a concentration equal to 5 mM and 10 mM exerted cytotoxic effect, which was reflected in (i) a decrease of cell proliferation, (ii) increase in the incidence of cell death, and (iii) disintegration of cultures, manifested with morphological and ultrastructural changes. Undoubtedly, it is necessary to elucidate the molecular mechanisms determining the underlying effects of metformin both
The authors declare that there is no conflict of interests regarding the publication of this paper.
The research was supported by Wroclaw Research Centre EIT+ under the Project “Biotechnologies and Advanced Medical Technologies,” BioMed (POIG.01.01.02-02-003/08), founded from the European Regional Development Fund (Operational Program Innovative Economy, 1.1.2). Publication supported by Wroclaw Centre of Biotechnology, programme the Leading National Research Centre (KNOW) for years 2014–2018.