Bone marrow derived mesenchymal stem cells (BM-MSCs) are considered as the most promising cells source for bone engineering. Cannabinoid (CB) receptors play important roles in bone mass turnover. The aim of this study is to test if activation of CB2 receptor by chemical agonist could enhance the osteogenic differentiation and mineralization in bone BM-MSCs. Alkaline phosphatase (ALP) activity staining and real time PCR were performed to test the osteogenic differentiation. Alizarin red staining was carried out to examine the mineralization. Small interference RNA (siRNA) was used to study the role of CB2 receptor in osteogenic differentiation. Results showed activation of CB2 receptor increased ALP activity, promoted expression of osteogenic genes, and enhanced deposition of calcium in extracellular matrix. Knockdown of CB2 receptor by siRNA inhibited ALP activity and mineralization. Results of immunofluorescent staining showed that phosphorylation of p38 MAP kinase is reduced by knocking down of CB2 receptor. Finally, bone marrow samples demonstrated that expression of CB2 receptor is much lower in osteoporotic patients than in healthy donors. Taken together, data from this study suggested that activation of CB2 receptor plays important role in osteogenic differentiation of BM-MSCs. Lack of CB2 receptor may be related to osteoporosis.
Bone tissue engineering provides alternative methods for bone defect treatment besides traditional solutions used in clinics, including autologous and allogeneic bone graft, vascularized grafts of the fibula and iliac crest, and other bone transplantation techniques [
There are two cannabinoid receptors both of which are G protein coupled receptors. Cannabinoid receptor type 1 (CB1 receptor) is mainly expressed in central nervous system [
In this study, we hypothesized that activation of CB2 receptor by chemical agonist could enhance the osteogenic differentiation and mineralization of bone marrow mesenchymal stem cells (BM-MSCs). Alkaline phosphatase activity staining and real-time PCR were performed to test the osteogenic differentiation. Alizarin red staining was carried out to examine the mineralization of BM-MSCs. Small interference RNA was used to study the role of CB2 receptor in osteogenic differentiation of BM-MSCs.
The use of human material in this study has been approved by a Local Medical Ethical Committee of China Medical University. Bone marrow biopsies were obtained from patients who underwent bone marrow examinations in the First Affiliated Hospital, China Medical University, by bone marrow aspiration. Healthy donors were defined as individuals without osteoporosis. Mesenchymal stem cells (MSCs) were derived from bone marrow of healthy donors as described previously [
Osteogenic differentiation was induced by culturing MSCs in osteogenic medium (OS) containing DMEM plus 10% FBS, 0.1 nM dexamethasone, 10 mM b-glycerophosphate, 0.01
After 3-week induction and treatment of CB2 receptor agonist UR-144 (10 nM), MSCs were fixed with 10% formalin. Then, mineralized nodules were stained with alizarin red S. After rinsing in phosphate-buffered saline (PBS), cells were incubated with 40 mM of alizarin red S (pH 4.2) for 10 min on under agitation. Cells were rinsed 5 times with water followed by 15 min washing with PBS to reduce nonspecific staining of alizarin red S. The stained nodules were observed through phase contrast microscope.
Cytochemical analysis with 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitro blue tetrazolium chloride (NBT) was used for the staining of alkaline phosphatase. MSCs were first fixed in 10% formalin. Then cells were incubated with 300–400
ImageJ software was used for quantification of positively stained area. Briefly, we manually set a threshold to avoid artifacts. Then colored images were transformed into binary images. Area of positive staining was divided by total area to make percentage of positively stained area. An average was made from three technical replicates for each donor. Values represent the mean
Samples of total RNA from chondrocytes seeded in cell culture plates or from freshly aspirated bone marrow were isolated with the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany). One microgram of total RNA was reverse-transcribed into cDNA using the iScript cDNA Synthesis kit (Bio-Rad, Hercules, CA). The cDNA samples were amplified with a Pfu PCR kit (Tiangen, Beijing, China), and the specific primers were displayed in Table
Sequences for primers.
Gene name | NCBI gene ID | Sequence ( |
Length of amplicon |
---|---|---|---|
Cannabinoid receptor 1 (CNR1) | 1268 | Forward: GTGTTCCACCGCAAAGATAGC |
130 |
|
|||
Cannabinoid receptor 2 (CNR2) | 1269 | Forward: AGCCCTCATACCTGTTCATTGG |
154 |
|
|||
Runt-related transcription factor 2 (RUNX2) | 860 | Forward: TGGTTACTGTCATGGCGGGTA |
101 |
|
|||
Osterix (OSX) | Forward: CCTCTGCGGGACTCAACAAC |
128 | |
|
|||
Integrin-binding sialoprotein (IBSP) | 3381 | Forward: CACTGGAGCCAATGCAGAAGA |
106 |
|
|||
Osteocalcin (OCN) | 632 | Forward: CACTCCTCGCCCTATTGGC |
112 |
|
|||
Secreted phosphoprotein 1 (SPP1) | 6696 | Forward: GAAGTTTCGCAGACCTGACAT |
91 |
|
|||
WNT5A | 7474 | Forward: ATTCTTGGTGGTCGCTAGGTA |
159 |
|
|||
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | 2597 | Forward: CTGGGCTACACTGAGCACC |
101 |
Real-time PCR was performed on cDNA samples by using the iQ SYBR Green Supermix (Bio-Rad, Hercules, CA). PCR reactions were carried out on MyiQ2 Two-Color Real-Time PCR Detection System (Bio-Rad, Hercules, CA) under the following conditions: cDNA was preheated for 15 min at 95°C, denatured for 5 min at 95°C, followed by 45 cycles, consisting of 15 s at 95°C, 15 s at 60°C, and 30 s at 72°C. For each reaction a melting curve was generated to test primer dimer formation and nonspecific priming. The primers for real-time PCR are listed in Table
Small interference RNA constructs which specifically knock down the expression of CNR2 were designed, synthesized, and cloned into a lentiviral vector (pLVshRNA-eGFP) also expressing GFP (Inovogen, Beijing, China). Details of lentiviral vector are available on the website of Inovogen (
MSCs with or without viral transduction were plated on glass cover slips in six-well plates 24 hours before staining. Cells were washed briefly with PBS, fixed in 4% paraformaldehyde for 30 min, at room temperature, and then permeabilized and blocked in 1% Triton-X 100 and 1% bovine serum albumin (BSA) for 15 min at room temperature. Slips were subsequently incubated overnight at 4°C with rabbit polyclonal antibodies against CB2 receptor (ab3561, AbCam, Cambridge, MA) or phospho-p38 MAPK (phospho T180, ab178867, AbCam, Cambridge, MA). Sequentially, slides were incubated with secondary antibodies conjugated to Alexa 594 (Invitrogen, Carlsbad, CA) or conjugated with FITC (Pierce, Rockford, IL) and nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI; Molecular Probes, Eugene, OR). After rinsing with PBS, cells were examined and imaged with DMi 6000 B fluorescent microscope (Leica, Bensheim, Germany).
Bone marrow tissues obtained from bone marrow examination were fixed in 10% formalin and then embedded in paraffin with routine histological procedures. 5
All statistical analysis was made by using Student’s
It is believed that CB1 receptor is mainly expressed in central nerve system [
Expression of cannabinoid receptors 1 and 2 in BM-MSCs. (a) RT-PCR analysis of cannabinoid receptors (CNR) 1 and 2 genes in BM-MSCs. Expression of cannabinoid receptor 2 was confirmed in BM-MSCs. GAPDH was used as internal control. PCR products were resolved on 2% agarose gel. (b) Immunofluorescent staining was performed to detect expression of CNR1 and CNR2 in BM-MSC at protein level. Bar = 100
To study the role of cannabinoid signaling in mineralization, specific agonist for CB2 receptor UR-144 is used to activate CB2 receptor on BM-MSCs during osteogenic differentiation. Alizarin red staining was performed to examine the mineralized nodules formed by BM-MSC cultured in osteogenic medium after 3 weeks. BM-MSCs cultured in osteogenic medium plus 10 nM of UR-144 show stronger staining than cells culture in osteogenic medium only (Figure
Osteogenic differentiation of BM-MSC was enhanced by agonist of cannabinoid receptor 2. (a) Alizarin red staining of BM-MSC after 3-week culture. Bar = 100
To test if inhibition of CB2 receptor would influence the mineralization of BM-MSCs, small interference RNA (siRNA) technology was used to knock down the expression of CB2 receptor in BM-MSCs. Constructs of siRNA were introduced into BM-MSCs by lentivirus. Green fluorescent protein (GFP) was applied as labels of positive transduction. After FACS sorting, all cells were positive for GFP (Figure
Osteogenic differentiation of BM-MSC was inhibited by knockdown of cannabinoid receptor 2. (a) BMSCs infected with virus containing shRNA sequence against cannabinoid receptor 2 (CNR2) or mock sequence. Green fluorescent protein (GFP) marks successfully infected cells. Bar = 100
Since activation of p38 mitogen-activated protein kinase (p38 MAPK) had been shown to stimulate osteogenic differentiation, we hypothesized that effects of CB2 receptor signaling on mineralization could be mediated through p38 MAPK. Figure
Knockdown of cannabinoid receptor 2 reduces phosphorylation of p38 MAPK. (a) Expression of phosphorylated p38 MAPK (phosphor-p38 MAPK) in BMSCs infected with virus containing mock sequence or siRNA sequence against cannabinoid receptor 2 (CNR2). Bar = 100
Finally, the expression of CB2 receptor was tested in human bone marrow tissue. Results of immunohistochemistry indicated that CB2 receptor is abundant in the bone marrow tissue of healthy donor. Meanwhile, barely any positive cells can be found in bone marrow of osteoporotic patients (Figure
Expression of cannabinoid receptor 2 in healthy and osteoporotic patients. (a) Immunohistochemistry shows presence of CB2 receptor in the bone marrow tissue of healthy donor, and absence in osteoporotic patients. Bar = 100
In this study, activation of CB2 receptor was shown to enhance the osteogenic differentiation and mineralization of BM-MSCs. Cells treated with CB2 receptor agonist presented higher alkaline phosphatase activity staining, more expression of osteogenic genes, and more deposition of calcium in extracellular matrix. Knockdown of CB2 receptor by small interference RNA in BM-MSCs severely reduced the osteogenic differentiation of BM-MSCs. Our data also indicated that activation of CB2 receptor was very likely acting through phosphorylation of p38 MAPK.
MSCs are considered as multipotent stem cells that can be isolated from many adult tissues, including bone marrow, dermis, muscles, ligament and placenta, and fat tissue [
The endogenous cannabinoids can bind to both CB1 and CB2 receptors. Both receptors contain seven-transmembrane domain. The two receptors are coupled to a subclass of G proteins that inhibit guanine nucleotide-binding and adenylyl cyclase activity [
Interestingly, knockdown of CB2 receptor reduced the ALP activity and calcium accumulation. This result implies that the CB2 might play an essential role in the differentiation steps of BM-MSCs towards osteoblasts. This also suggested that MSCs might produce endogenous cannabinoid to allow themselves to differentiate into osteogenic lineage. The autocrine effects of cannabinoid of MSCs would need more investigation in the future.
Taken together, our data demonstrated a new mechanism in which osteogenic differentiation and mineralization can be enhanced by activating CB2 receptor. Our results also suggested that lack of CB2 receptor is associated with osteoporosis. Increasing CB2 signaling may be useful in both prompting bone tissue engineering products and treating osteoporotic patients.
The authors declare that there is no conflict of interests regarding the publication of this paper.
This study is funded by National Natural Science Foundation of China (81272167).