DNA methylation plays critical roles in regulation of microRNA expression and function. miR-23a-27a-24-2 cluster has various functions and aberrant expression of the cluster is a common event in many cancers. However, whether DNA methylation influences the cluster expression and function is not reported. Here we found a CG-rich region spanning two SP1 sites in the cluster promoter region. The SP1 sites in the cluster were demethylated and methylated in Hep2 cells and HEK293 cells, respectively. Meanwhile, the cluster was significantly upregulated and downregulated in Hep2 cells and HEK293 cells, respectively. The SP1 sites were remethylated and the cluster was significantly downregulated in Hep2 cells into which methyl donor, S-adenosyl-L-methionine, was introduced. Moreover, S-adenosyl-L-methionine significantly increased Hep2 cell viability and repressed Hep2 cell early apoptosis. We also found that construct with two SP1 sites had highest luciferase activity and SP1 specifically bound the gene cluster promoter in vitro. We conclude that demethylated SP1 sites in miR-23a-27a-24-2 cluster upregulate the cluster expression, leading to proliferation promotion and early apoptosis inhibition in laryngeal cancer cells.
miR-23a, miR-27a, and miR-24-2 consist of miR-23a-27a-24-2 gene cluster which is highly conserved in different species. miR-23a-27a-24-2 cluster and its individual members play important roles in various biological and pathological processes such as cell development [
Aberrant miR-23a-27a-24-2 cluster expression is reported to be a common event in lots of cancers such as acute lymphoblastic leukemia [
However, why miR-23a-27a-24-2 cluster is aberrantly expressed is seldom reported. From genetics level, only amplification is confirmed to upregulate the cluster expression in gastric cancer cells [
In our previous study, we found that miR-23a and miR-27a are upregulated in laryngeal cancer [
In the study, we predicted CG-rich region of miR-23a-27a-24-2 cluster promoter and detected the methylation status in the region spanning two SP1 sites. We also investigated whether methylation status of SP1 sites affects the cluster expression and proliferation and apoptosis in Hep2 cells.
Human laryngeal carcinoma cells Hep2 and human embryonic kidney cells HEK-293 were obtained from Cell Biology Institute of Shanghai, Chinese Academy of Science. Hep2 and HEK 293 cells were maintained in RPMI-1640 and Dulbecco’s high glucose modified Eagle’s medium (DMEM), respectively, with 10% fetal bovine serum, 100 nits/mL penicillin, and 100
To detect the expression of miR-23a/27a/24-2 cluster in Hep2 and HEK293 cell lines, total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA) following the protocol of the manufacturer. Reverse transcription was performed using the One Step Prime Script miRNA cDNA Synthesis Kit (Takara, Dalian, China) following the manufacturer’s instructions. qRT-PCR was performed using SYBR® Premix Ex Taq
Primer sequences of miR-23a/27a/24-2 cluster used in the study.
Primer name | Sequence |
---|---|
miR-23a | F: 5′-ATCAC ATTCGCAGGGATTTCC-3′ |
RTQ-UNIr: | |
5′-CGAATTCTAGACGTCGAGCGAGCGGA CATGCGTGCGTAGTTAACGTTGGTACCGACGTCGGATCCACTAGTCC (T)-3′ | |
|
|
miR-27a | F: 5′-TTCACAGTGCGTAAGTTCCCG-3′ |
RTQ-UNIr: | |
5′-CGAATTCTAGACGTCGAGCGAGCGGA CATGCGTGCGTAGTTAACGTTGGTACCGACGTCGGATCCACTAGTCC (T)-3′ | |
|
|
miR-24-2 | F: 5′-TGCGTCAGTTCACGAGGAACAG-3′ |
RTQ-UNIr: | |
5′-CGAATTCTAGACGTCGAGCGAGCGGA CATGCGTGCGTAGTTAACGTTGGTACCGACGTCGGATCCACTAGTCC (T)-3′ | |
|
|
U6 | F: 5′-CTCCGTTCGCGACGACA-3′ |
R: 5′-AACCGTTCACGAATTTCGGT-3′ |
Hep2 cells were treated by SAM. Genomic DNAs isolated from Hep2, HEK-293, and SAM-treated Hep2 cells were used to detect methylation status of CG-rich region in miR-23a/27a/24-2 cluster promoter. Genomic DNA was then bisulfite-modified using the EZ DNA Methylation-Gold
Hep2 cells were treated by SAM at 0.2 mM, 0.4 mM, 0.6 mM, 0.8 mM, and 1.0 mM concentrations, respectively. SAM-untreated Hep2 cells were used as controls. 3-4 × 104 cells were seeded into each well of a 96-well culture plate to a final volume of 100
Apoptotic cells were measured by using an Annexin-V:FITC Apoptosis Detection Kit I (BD Biosciences, San Jose, CA, USA) according to the manufacturer’s protocol. Hep2 cells were incubated with 0.2 mM, 0.4 mM, 0.6 mM, 0.8 mM, and 1.0 mM SAM for 72 h, respectively. Cells were then harvested, washed twice with 1x PBS, and resuspended in 100
p450, p498, and p603 constructs containing zero, one, and two SP1 sites in the cluster, respectively, were obtained from GENECHEM (Shanghai, China). Cells seeded in 96-well plate in triplicate were transfected with different constructs by using Lipofectamine 2000
Nuclear extracts of Hep2 cells were prepared using a nuclear extract kit (Pierce, USA) following the manufacturer’s instructions. Oligonucleotides used in EMSA were synthesized by Sangene (Beijing, China), and their sequences were as follows: SP1 wild type: 5′-CTCTGGGGGCGGGGGGGTCGG-3′ and mutant: 5′-CTCTGGAGAATAAGAGGTCGG-3′. The oligonucleotides were labeled using the biotin 3′ end DNA Labeling Kit (Pierce, USA). EMSA was performed by LightShift Chemiluminescent EMSA kit (Pierce, USA) according to the protocol provided. In brief, nuclear protein extracts were incubated with 3′-end-biotin-labeled probes in binding buffer for 20 min on ice, separated on a 6% nondenaturing polyacrylamide gel, and then transferred onto a nylon membrane and fixed by ultraviolet cross-linking. Protein-DNA complexes were visualized by streptavidin-horseradish peroxidase followed by chemiluminescent detection (Pierce, USA). For competition assays, nuclear protein extracts were incubated with a 100-fold excess of the unlabeled wild type and mutated oligonucleotide duplex competitors, respectively. For supershift reaction, anti-SP1 antibody (Abcam, USA) was incubated with nuclear extracts for 1 h at 4°C prior to the addition of the biotin-labeled DNA probes.
Unless otherwise stated, each experiment was performed for a minimum of three times. Data were subjected to statistical analysis by SPSS 16.0 software and shown as mean ± standard deviation (SD). A paired samples
As shown in Figure
Effects of DNA methylation status of miR-23a-27a-24-2 cluster promoter CG-rich region on the cluster expression. (a) Prediction of miR-23a-27a-24-2 cluster promoter CG-rich region. CG-rich region spanning two SP1 sites is located at the cluster promoter, −530~−410. (b) DNA methylation status of the CG-rich region in Hep2 and HEK-293 cells. Cytosines of CG dinucleotides in the two SP1 sites were hypermethylated in HEK-293 cells compared to Hep2 cells. (c) Expression of miR-23a-27a-24-2 cluster in Hep2 and HEK-293 cells. Members of the cluster were upregulated in Hep2 cells compared to HEK-293 cells. (d) DNA methylation status of the CG-rich region in SAM-treated and SAM-untreated Hep2 cells. Cytosines of CG dinucleotides in the two SP1 sites were remethylated in SAM-treated Hep2 cells compared to SAM-untreated cells. (e) Expression of miR-23a-27a-24-2 cluster in SAM-treated and SAM-untreated Hep2 cells. Members of the cluster were downregulated in SAM-treated Hep2 cells compared to SAM-untreated cells. Hep2 cells were incubated with 1 mmol/L SAM. SAM-untreated cells were used as controls.
qRT-PCR results indicated that three members of miR-23a-27a-24-2 cluster were significantly overexpressed in Hep2 cells compared to HEK-293 cells (Figure
To identify whether methylation status of the CpG-rich region affects Hep2 cell functions, we detected Hep2 cell proliferation and apoptosis by MTT and flow cytometry methods, respectively. MTT results showed a decreased viability tendency with the increase of concentration and treatment duration of SAM compared to the controls (Figure
Effects of DNA methylation status of miR-23a-27a-24-2 cluster promoter CG-rich region on proliferation and apoptosis. (a) Inhibition of different concentrations of SAM on Hep2 cell growth. (b) Inhibition analysis of 0.8 mmol/L SAM on Hep2 cell growth. (c) Early apoptosis analysis of different concentrations of SAM on Hep2 cells on the third day.
Luciferase reporter assay result indicated that construct overlapping two SP1 sites had strongest luciferase activity and even that harbouring one SP1 site showed significantly higher luciferase ability compared to the controls (Figure
Activities of miR-23a-27a-24-2 cluster promote and binding of SP1 to the cluster CG-rich region. (a) Relative luciferases of different constructs in miR-23a-27a-24-2 cluster are promoted. (b) Binding of SP1 to the cluster CG-rich region in vitro.
It is well-known that transcription factors regulate target gene expression via binding cis-acting elements [
miR-23a-27a-24-2 cluster promoter is located at the region −603 bp~+38 bp that lacks the known common promoter element TATA box [
Recently, miR-23a and 27a are reported in an aberrant methylation status in several studies. Similar to our results, miR-23a overexpression is speculated to be associated with its hypomethylation in leukemic cells [
It is also well-known that miRNAs participate in regulation of cancer cell proliferation, apoptosis, differentiation, migration, and metastasis via different targets [
In the present study, SAM-treated Hep2 cells showed significantly lower level of proliferation and higher level of apoptosis than controls, indicating that SAM increases proliferation and decreases apoptosis in laryngeal cancer cells. SAM-induced proliferation prevention and apoptosis activation have been found in other studies. For example, SAM inhibits osteosarcoma and colorectal cancer cell proliferation [
We conclude that demethylated SP1 sites in CG-rich region of miR-23a-27a-24-2 cluster promoter result in the cluster overexpression, leading to proliferation promotion and apoptosis inhibition probably via targeting the related targets such as APAF-1 and PLK2 in laryngeal cancer cells. These provide us with an important basis in our future work on miR-23a-27a-24-2 cluster promoter methylation in human cancer tissues and its clinical significance in tumorigenesis.
Ye Wang and Zhao-Xiong Zhang are co-first authors
The authors declare that they have no competing interests.
Ye Wang, Zhao-Xiong Zhang, and Sheng Chen performed the experiment. Wei-Neng Fu and Zhen-Ming Xu designed the research. Guang-Bin Qiu carried out data analysis. Wei-Neng Fu wrote the paper.
This work was supported by two grants from the National Natural Science Foundations of China (81172577 and 81372876).