For a long time, oxytocin (OT), a neurohypophyseal hormone, was regarded as a pivotal factor in the stimulation of uterine contraction during labour, milk ejection, and the formation of maternal behaviour [
The mRNA for OT receptors was demonstrated not only in the central nervous system and in the uterus, but also in the atria, ventricles, caval veins, and the aorta. Further observation provided evidence for the heart and vasculature as sites of OT synthesis [
The rationale of the present study was to elucidate whether the development of postinfarction heart failure is associated with a change of activity of the oxytocinergic system in cardiomyocytes. Despite promising results of the role of OT in cardioprotection, the activity of the oxytocinergic system in the development of postmyocardial heart failure has not yet been investigated.
All surgical and experimental protocols were conducted according to the international/EU guidelines and regulations on the use and care of laboratory animals. The experimental protocol was approved by the Second Local Animal Research Ethics Committee. All experiments were performed on 30 male Sprague-Dawley rats (SPRD/Möl/Lod, 250–350 g) bred in the Department of Animal Breeding. The rats were housed (2-3 animals per cage) under standard conditions including 12 h/12 h light/dark cycle (light on at 7.00 a.m.) in a room with regulated temperature (range: 22–25°C) and were fed a standard rat diet and allowed access to water
The animals were divided at random into two groups. One group was subjected to myocardial infarction (
The myocardial infarction was produced according to the technique described previously [
Four weeks after the sham surgery or myocardial infarction, the rats were anaesthetised with pentobarbital sodium (5 mg/100 g body wt. i.p.; 20
Tissue samples were homogenized at a frequency of 25 Hz for 5 minutes in a TissueLyser (Qiagen GmbH, Hilden, Germany) homogenizer. Isolation of total RNA was performed automatically on a BioRobot EZ1 using the EZ1 RNA Universal Tissue Kit (Qiagen, Germany) according to the manufacturer’s instructions (Qiagen GmbH, Hilden, Germany). RNA concentration and purity were assessed with a NanoDrop spectrophotometer at 260 nm (ND-1000 Spectrophotometer, Thermo Fisher Scientific Inc.).
Real-time PCR was performed on a ViiA™ 7 Real-Time PCR System using TaqMan® RNA-to-
Sequences of oligonucleotides used in the present study.
Gene | Sense primer (5′-3′) | Antisense primer (5′-3′) | Accession number |
---|---|---|---|
OT, | GACGGTGGATCTCGGACTGAA | CGCCCCTAAAGGTATCATCACAAA | Rn00564446_g1 |
OTR, | GTCAATGCGCCCAAGGAAG | GATGCAAACCAATAGACACC | Rn00563503_m1 |
ANP, | CAGCATGGGCTCCTTCTCCA | GTCAATCCTACCCCCGAAGCAGCT | Rn00664637_g1 |
BNP, | CCATCGCAGCTGCCTGGCCCATCACT | GACTGCGCCGATCCGGTC | Rn00580641_m1 |
BNP: B-type natriuretic peptide; OT: oxytocin; OTR: oxytocin receptor.
The following EIA Kits were used for the evaluation of oxytocin, oxytocin receptor concentration in the heart’s homogenates, and N-terminal prohormone B-type natriuretic peptide (NT-proBNP) in plasma: Oxytocin EIA Kit (Phoenix Pharmaceuticals Inc., USA), Oxytocin Receptor EIA Kit (Sunred Biological Technology Co. Ltd., China), and NT-proBNP (Wuhan EIAab Science Co. Ltd., China). For the ventricle cardiac muscle, each sample of tissue was homogenized in the TissueLyser bead mixer (Qiagen, USA) and centrifuged (10 000 rpm for 10 minutes, 4°C). The supernatant was collected and frozen at −80°C until analysis. Total protein concentration was measured using bicinchoninic acid (BCA) Protein Assay Kit (Pierce, Holland), according to the manufacturer’s instructions. Results obtained were presented as an absolute ratio: concentration/total protein concentration (×10−9) for OT and OTR and total protein concentration (pg/mL) for plasma NT-proBNP.
All values presented in the text and figures are means ± SE. STATISTICA software (version 10) was used for statistical analysis of the data. One-way ANOVA followed by the Tukey
Total body mass in the infarcted and sham-operated rats was equal to 287.5 ± 12.1 g and 290.5 ± 6.1 g, respectively, and did not differ significantly. We did not find significant differences between the masses of the left ventricle in infarcted and sham-operated rats (0.22 ± 0.004 versus 0.24 ± 0.01 g). Right ventricle mass was significantly higher in the infarcted rats (0.08 ± 0.004 versus 0.06 ± 0.002 g [
Plasma NT-proBNP concentration was significantly higher in the infarcted rats (Figure
Serum NT-proBNP concentration (a) and average expression of BNP mRNA (b) and ANP mRNA (c) in the fragments of the left ventricle muscle in the sham-operated rats (control) and in rats with myocardial infarction (infarct). Arbitrary units: relative gene expression was given on the basis of estimations of the values of the delta cycle threshold (ΔCt) by relative quantification to the endogenous control. Means ± standard errors are shown. Significant differences between the experimental groups:
In the infarcted rats, expression of OT mRNA [
Average expression of oxytocin (OT) mRNA (a) and protein (b) in the left and right ventricle muscles in the sham-operated rats (control) and in rats with myocardial infarction (infarct). Arbitrary units: relative gene expression was given on the basis of estimations of the values of the delta cycle threshold (ΔCt) by relative quantification to the endogenous control. Oxytocin concentration presented as an absolute ratio: oxytocin/total protein concentration. Means ± standard errors are shown. Significant differences between the experimental groups:
We found that the OTR mRNA expression was significantly lower in the infarcted rats both in the left ventricle [
Average expression of oxytocin receptor (OTR) mRNA (a) and protein (b) in the left and right ventricle muscles in the sham-operated rats (control) and in rats with myocardial infarction (infarct). Arbitrary units: relative gene expression was given on the basis of estimations of the values of the delta cycle threshold (ΔCt) by relative quantification to the endogenous control. Oxytocin receptor concentration presented as an absolute ratio: oxytocin/total protein concentration. Means ± standard errors are shown. Significant differences between the experimental groups:
In the present study, we show for the first time that postinfarction heart failure is associated with significant changes in both the mRNA expression and the protein level of the intracardiac oxytocin and oxytocin receptor. By analyzing the results of protein expression for both OT and OTR, we conclude that the experimental model of postinfarct heart failure was associated with an increase in activity of the heart’s oxytocinergic system.
Results of past studies revealed that OT increases the release of natriuretic peptide, a powerful marker of the left ventricle systolic function, from the heart [
It should be emphasized that in our study we showed, for the first time, changes in the expression of OT and OTR mRNA and the level of OT and OTR protein four weeks after myocardial infarction, which was reported previously as sufficient time for the development of postinfarct heart failure [
In our study, we observed a decrease of OTR mRNA while the OTR protein level in the ventricles of the infarcted rats increased four weeks after myocardial infarction. A suggested mechanism(s) of the observed dissociation between OTR mRNA and its protein may involve desensitization and internalization of OTRs or changes in the regulation of synthesis and degradation of mRNA. Additionally, the dissociation may be disease-dependent, particularly during the progression of heart failure. It has been shown that, in HEK293 cells, internalization of OTR occurs mainly due to the clathrin-dependent pathway, but another mechanism involved in the internalization of OTR into cellular membrane caveolae has been proposed [
In the present study, we found higher expression of OT mRNA and higher protein levels in the fragments of the right but not in the left ventricle. The data from previous studies indicate that the OT concentration is the highest in the right atrium in comparison with the left atrium and in the right ventricle in comparison with the left ventricle cardiomyocytes [
The results from the present study may suggest an increased activity of the oxytocinergic system in the heart as another aspect of the OT cardioprotective function in the experimental model of myocardial infarction. Results from recent studies indicate that increased activity of the oxytocinergic system in experimental models of left ventricle damage may slow down the progression of heart failure due to the reduction of the infarct size and cardiac remodelling. In the study by Jankowski et al., the treatment with OT chronic infusions over 7 days following myocardial infarction resulted in the improvement of the left ventricle systolic function, reduction of apoptosis, expression of proinflammatory cytokines transcripts, and inflammatory cell migration in the infarct region [
In conclusion, the main finding of the present study is that postmyocardial infarction heart failure is associated with an increased activity of the intracardiac oxytocinergic system. As oxytocin was found as a novel and important cardioprotective factor in myocardial ischaemia and was also shown to increase natriuretic peptide release, we therefore suggest that increased activity of the intracardiac oxytocinergic system after left ventricle damage may have an inhibitory impact on the progression of heart failure. According to the importance of this novel issue in the pathophysiology of heart failure, further investigations on oxytocin in heart failure are incontestably necessary.
The authors report no financial or other competing interests relevant to the subject of this publication.
The authors would like to express their gratitude to Mrs. Małgorzata Kowalczyk for her technical assistance and to Mr. Marcin Kumosa for the preparation of the illustrations. This study was supported by grants from the Warsaw Medical University (1MA/PM12/14/14; 1MAW2/2015).