Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.
Despite the significant progress for prevention of the rabies disease and its control in the developing countries, this disease still causes over 60 thousand human deaths every year. Rabies disease is caused by infection with viruses of the family Rhabdoviridae, genus
Although all mammals are susceptible to lyssaviruses, bats and carnivores are the major
The direct fluorescent antibody test (FAT) is the “gold standard” for rabies diagnosis [
The reactivity of certain viral isolates does not match the reactivity patterns in some cases [
Primer design was based on the alignment constructed with ClustalW using complete RABV N gene sequences available in GeneBank associated variant; these were designed in consensus region. Two pairs of the primers (external and internal) were designed for each of the RABV variants associated, and the maximum average entropy (Hx) and the maximum entropy of each position were calculated using Bio Edit v7.2.5.
Two external primers and two internal primers were designed for dogs variant; 36 N gene sequences were obtained from different Mexican states; for the vampire bats variant, 18 N gene sequences were considered from Mexican states; for the nonhematophagous bat variant, the primer design comprised 50 N gene complete sequences from hosts
RABV N gene sequence for external and internal primer design for different rabies variant.
Nonhematophagous bat | |||
GI | Host | Country | Collection date |
|
|||
AF351832.1 |
|
||
GU644667.1 |
|
USA: Michigan | 2005 |
GU644664.1 |
|
USA: Michigan | 2003 |
GU644662.1 |
|
USA: Michigan | 2003 |
AY039229.1 |
|
USA: Adams County, Pennsylvania | 1984 |
AY039228.1 |
|
USA: El Paso County, Colorado | 1985 |
GU644676.1 |
|
USA: Virginia | 2004 |
GU644668.1 |
|
USA: Michigan | 2005 |
AF351862.1 |
|
||
GU644655.1 |
|
USA: Iowa | 2005 |
GU644695.1 |
|
USA: Washington | 2005 |
GU644661.1 |
|
USA: Michigan | 2003 |
AY039227.1 |
|
USA: Washington | 1987 |
GU644677.1 |
|
USA: Virginia | 2004 |
GU644670.1 |
|
USA: Michigan | 2005 |
GU644666.1 |
|
USA: Michigan | 2005 |
GU644660.1 |
|
USA: Michigan | 2003 |
GU644656.1 |
|
USA: Iowa | 2005 |
GU644654.1 |
|
USA: Iowa | 2005 |
GU644690.1 |
|
USA: Washington | 2004 |
GU644669.1 |
|
USA: Michigan | 2005 |
AF351861.1 |
|
||
GU644689.1 |
|
USA: Washington | 2004 |
GU644684.1 |
|
USA: Washington | 2003 |
GU644663.1 |
|
USA: Michigan | 2003 |
GU644659.1 |
|
USA: Michigan | 2003 |
GU644657.1 |
|
USA: Michigan | 2003 |
AF351833.1 |
|
||
AF351828.1 |
|
||
GU644665.1 |
|
USA: Michigan | 2005 |
GU644671.1 |
|
USA: New Jersey | 2005 |
GU644658.1 |
|
USA: Michigan | 2003 |
GU644652.1 |
|
USA: Georgia | 2004 |
AF351831.1 |
|
||
AF351855.1 |
|
||
GU644754.1 |
|
USA: Florida | 2001 |
AF351854.1 |
|
||
AF394868.1 |
|
USA: Monterey, California | 1991 |
AY039225.1 |
|
USA: Highlands County, Florida | 1988 |
AF351829.1 |
|
||
AF394871.1 |
|
USA: Plumas County, California | 1987 |
AF351859.1 |
|
||
AF351860.1 |
|
||
GU644673.1 |
|
USA: New Jersey | 2005 |
AY039226.1 |
|
USA: Perry County, Pennsylvania | 1984 |
AF351839.1 |
|
||
AF351853.1 |
|
||
HQ341796.1 |
|
Chile | 2009 |
AF351827.1 |
|
||
GU644675.1 |
|
USA: New Jersey | 2005 |
|
|||
Skunk | |||
GI | Host | Country | Collection date |
|
|||
JQ513553 | Skunk V854 | Mexico: San Luis Potosí | 2002 |
JQ513552 | Skunk V658 | USA: Mariposa County, California | 1997 |
JQ513548 | Skunk V652 | USA: Mariposa County, California | 1997 |
JQ513547 | Skunk V651 | USA: Mariposa County, California | 1997 |
JQ513551 | Fox V657 | USA: Mariposa County, California | 1997 |
JQ513541 | Dog V640 | USA: Sonoma County, California | 1994 |
JQ513546 | Skunk | USA: Trinity County, California | 1997 |
JQ513542 | Mountain lion | USA: Yolo County, California | 1994 |
JQ513545 | Skunk | USA: Mendocino County, California | 1997 |
JQ513549 | Skunk | USA: Amador County, California | 1997 |
JQ513539 | Skunk | USA: Glenn County, California | 1994 |
JQ513544 | Skunk | USA: Colusa County, California | 1994 |
JQ513540 | Skunk | USA: Sutter County, California | 1994 |
JQ513550 | Skunk | USA: Glenn County, California | 1997 |
FJ228485 | Cow | Mexico: Chihuahua | 1999 |
FJ228484 |
|
Mexico: San Luis Potosí | 2002 |
FJ228483 |
|
Mexico: Zacatecas | 2001 |
JX856026.1 |
|
USA | 2009 |
JX856036.1 | Bovine (cow) | USA | 2009 |
JX856035.1 |
|
USA | 2009 |
JX855972.1 |
|
USA | 2009 |
JX856024.1 |
|
USA | 2009 |
JX856023.1 | Bovine (cow) | USA | 2009 |
JX856017.1 | Bovine (cow) | USA | 2009 |
JX856016.1 |
|
USA | 2009 |
JX856015.1 |
|
USA | 2009 |
JX856014.1 |
|
USA | 2009 |
JX856006.1 |
|
USA | 2009 |
JX856004.1 |
|
USA | 2009 |
JX856001.1 |
|
USA | 2009 |
JX855993.1 |
|
USA | 2009 |
JX855990.1 |
|
USA | 2009 |
JX855980.1 |
|
USA | 2009 |
JX855988.1 |
|
USA | 2009 |
JX855987.1 |
|
USA | 2009 |
JX855986.1 |
|
USA | 2009 |
JX855985.1 |
|
USA | 2009 |
JX855984.1 |
|
USA | 2009 |
JX855981.1 |
|
USA | 2009 |
JX855979.1 |
|
USA | 2009 |
JX855973.1 |
|
USA | 2009 |
JX855976.1 |
|
USA | 2009 |
JX855975.1 |
|
USA | 2009 |
JX855974.1 |
|
USA | 2009 |
JX855970.1 |
|
USA | 2009 |
JX855968.1 |
|
USA | 2009 |
JX855967.1 |
|
USA | 2009 |
JX855966.1 |
|
USA | 2009 |
JX855965.1 |
|
USA | 2009 |
JX855963.1 |
|
USA | 2009 |
JX855962.1 |
|
USA | 2009 |
|
|||
|
|||
GI | Host | Country | Collection date |
|
|||
FJ228513.1 |
|
Mexico: Estado de México | 2000 |
FJ228512.1 |
|
Mexico: Estado de México | 2002 |
FJ228507.1 |
|
Mexico: Estado de México | 1999 |
FJ228532.1 |
|
Mexico: Puebla | 1995 |
FJ228506.1 |
|
Mexico: Guerrero | 1999 |
FJ228505.1 |
|
Mexico: Tlaxcala | 2002 |
FJ228504.1 |
|
Mexico: Puebla | 2001 |
FJ228503.1 |
|
Mexico: Tlaxcala | 2000 |
FJ228502.1 |
|
Mexico: Distrito Federal | 1999 |
KJ001535.1 |
|
Mexico | 2005 |
KJ001525.1 |
|
Mexico | 2009 |
KJ001524.1 |
|
Mexico | 2005 |
KJ001518.1 |
|
Mexico | 2011 |
KJ001517.1 |
|
Mexico | 2011 |
KJ001516.1 |
|
Mexico | 2011 |
KJ001515.1 |
|
Mexico | 2011 |
KJ001509.1 |
|
Mexico | 2009 |
KJ001502.1 |
|
Mexico | 2006 |
KJ001500.1 |
|
Mexico | 2006 |
KJ001499.1 |
|
Mexico | 2006 |
KJ001492.1 |
|
Mexico | 2005 |
KJ001490.1 |
|
Mexico | 2005 |
KJ001488.1 |
|
Mexico | 2005 |
FJ228525.1 |
|
Mexico: Yucatán | 2002 |
FJ228523.1 |
|
Mexico: Yucatán | 1998 |
FJ228521.1 |
|
Mexico: Durango | 1991 |
FJ228518.1 |
|
Mexico: Chiapas | 2002 |
FJ228511.1 |
|
Mexico: Puebla | 1994 |
FJ228510.1 |
|
Mexico: Distrito Federal | 1991 |
FJ228509.1 |
|
Mexico: Distrito Federal | 1990 |
FJ228508.1 |
|
Mexico: Distrito Federal | 1991 |
FJ228522.1 |
|
Mexico: Chihuahua | 1994 |
FJ228519.1 |
|
Mexico: Michoacán | 1990 |
AY854591.1 |
|
Mexico | |
AY854589.1 |
|
Mexico | |
FJ228526.1 |
|
Mexico: Coahuila | 2001 |
|
|||
|
|||
GU991828.1 | Desmodontinae (vampire bat V3) | ||
GU991827.1 | Desmodontinae (vampire bat V3) | Mexico: East Mexico | 1999 |
GU991826.1 | Desmodontinae (vampire bat V3) | Mexico: East Mexico | 1999 |
GU991825.1 | Desmodontinae (vampire bat V3) | Mexico: East Mexico | 2004 |
GU991824.1 | Desmodontinae (vampire bat V11) | Mexico: East Mexico | 2002 |
GU991823.1 | Desmodontinae (vampire bat V11) | East Mexico | 2003 |
KP202393.1 | Desmodontinae (vampire bat) | Mexico | 1988 |
AY854592.1 | Desmodontinae (vampire bat) | Mexico | |
AY854587.1 | Desmodontinae (vampire bat) | Mexico | |
AY854595.1 | Desmodontinae (vampire bat) | Mexico | |
AY854594.1 | Desmodontinae (vampire bat) | Mexico | |
FJ228491.1 |
|
Mexico: Tamaulipas | 2003 |
FJ228490.1 |
|
Mexico: Veracruz | 2003 |
FJ228489.1 |
|
Mexico: Hidalgo | 2003 |
FJ228488.1 |
|
Mexico: San Luis Potosí | 2004 |
AY877435.1 | Desmodontinae (vampire bat) | ||
AY877434.1 | Desmodontinae (vampire bat) | ||
AY877433.1 | Desmodontinae (vampire bat) |
Twenty-three brain samples collected in Mexico were used as follows: nine brain samples tested negative by FAT and fourteen tested positive by FAT and typed by MAbs: these RABV isolated consisted of six samples of dog brain, one sample of skunk, two samples of cow, two samples of vampire bat, and three samples of nonhematophagous bat (Table
RABV isolated typed by MAbs used in the present study.
Sample | Sample name | Host species | Antigenic variant |
---|---|---|---|
1 | 68EDOMEXDOG05 | Dog 068 | V1 |
2 | 647EDOMEXDOG05 | Dog 647 | V1 |
3 | 659EDOMEXDOG05 | Dog 659 | V1 |
4 | 748EDOMEXDOG05 | Dog 748 | V1 |
5 | 2293EDOMEXDOG05 | Dog 2293 | V1 |
6 | 885EDOMEXDOG05 | Dog 885 | V1 |
7 | 658EDOMEXCOW05 | Cow 658 | V8 |
8 | 460EDOMEXCOW11 | Cow 460 | V8 |
9 | 757EDOMEXMUR06 | Bat nonhematophagous 757 | A |
10 | 1594EDOMEXVAM07 | Bat nonhematophagous 1594 | V5 |
11 | 1079EDOMEXMUR08 | Bat nonhematophagous 1079 | None |
12 | 3919EDOMEXVAM05 | Vampire bat 3919 | None |
13 | 110EDOMEXVAM06 | Vampire bat 110 | Atypical |
14 | 1369EDOMEXSK06 | Skunk 1369 | V8 |
15 | 65EDOMEXDOG05 | Dog | NA |
16 | 543EDOMEXDOG05 | Dog | NA |
17 | 642EDOMEXDOG05 | Dog | NA |
18 | 223EDOMEXDOG05 | Skunk | NA |
19 | 1001EDOMEXDOG05 | Skunk | NA |
20 | 455EDOMEXDOG05 | Cow | NA |
21 | 755EDOMEXDOG05 | Bat nonhematophagous | NA |
22 | 2187EDOMEXDOG05 | Vampire bat | NA |
23 | Negative control | CN | NA |
All samples are from Mexican state. Varian antigenic test: V1, dog; V5,
The brain tissues (approximately 3 mm3) were homogenized in 200
The reverse transcription reaction was performed using four singleplex reactions with external primers and SuperScript®III Platinum® One-Step qRT-PCR kit (Invitrogen) in 50
Primer details for host mammals specific rabies virus variants detection in Mexico.
Primer name | Sequence (3′ to 5′) | Sense | Rabies variant detection | Fragment size (pb) | Tm (°C) | Length |
|
---|---|---|---|---|---|---|---|
E | VAMPIROF | TTCAAGGTCAATAATCAGGTGGTCTCTC | F | Vampire bat | 836 | 59 | 22–49 |
VAMPIRORC | AGACTGCTGTTCCTCATTCCTATTT | R | 53.8 | 833–857 | |||
I | FBVFQ | ATTGGGCTCTAACAGGGGGCAT | F | 177 | 59.6 | 356–377 | |
FBVRCQ | ATAGAGCAGATTTTCGAGACAGCCCCCT | R | 62.5 | 575–602 | |||
|
|||||||
E | PERROF | TTCAAAGTCAATAATCAGGTGGTC | F | Dog | 1288 | 51.9 | 22–45 |
PERRORC | AATCATCAAGCCCGTCCAAACT | R | 56.4 | 1288–1309 | |||
I | FBPFQ | CAAGAATATGAGGCGGCTGAACT | F | 212 | 55 | 1099–1120 | |
PERRORC | AATCATCAAGCCCGTCCAAACT | R | 56.4 | 1288–1309 | |||
|
|||||||
E | MURCIELAGOF | GACCCTGATGATGTATGCTCTTAT | F | Bat | 668 | 51 | 196–219 |
MURCIELAGORC | GTTCCTCACTCYTATTTCATCCA | R | 50.6 | 742–764 | |||
I | FBMFQ | GCTTGACCCTGATGATGTATGCTCTTAT | F | 184 | 59 | 192–219 | |
FBMRCQ | TGGGCTCTAACAGGGGGTATGG | R | 58.7 | 358–379 | |||
|
|||||||
E | ZORRILLOF | ATAGAACAGATTTTTGAGACGGC | F | Skunk | 794 | 51.4 | 505–527 |
ZORRILLORC | TGTCTCAGTTAGTTCCAATCATCAAGC | R | 56.9 | 1272–1298 | |||
I | ZORRILLOF | ATAGAACAGATTTTTGAGACGGC | F | 359 | 51.4 | 506–527 | |
FBZRCQ | GTTCCTCACTCCTATTTCATCCA | R | 51.7 | 742–764 |
Nested endpoint PCR and real-time RT-PCR primers designed. E: external; I: internal; F: forward; R: reverse.
For nested PCR, 1
The one-step real-time PCR was performed using internal primers and LCFastStart RNA Master SYBR Green I kit (Roche, Germany) in 20
The set of primers for specific RABV variants was designed aligning the sequence of N gene region. Four regions highly conserved were selected for two external primers and two internal primers designed, with more than 90% of conservation, for each variant and high variability between variants. Two mismatches were permitted for the primers design, and less was possible for the internal primers located at the primers beginning or end.
As the maximum entropy values increased, the number of identified conserved regions, their length, the coverage of conserved regions, and the average length of single conserved regions also increased. Two external primers and two internal primers were designed for dog-associated variant; the alignment presented a high conservation level (Figure
External and internal primer alignments for dog specific RABV variant detection. (a) Forward sequence of the external primer named PERROF. (b) Reverse sequence of the external primer named reverse PERRORC. (c) Forward sequence of the internal primer named FBPFQ. (d) Reverse sequence of the internal primer named PERRORC.
The external and the internal primer alignments for skunk specific RABV variant detection. (a) Forward sequence of the external primer named ZORRILLOF. (b) Reverse sequence of the external primer named ZORRILLORC. (c) Internal primer named ZORRILLOF. (d) Reverse sequence of the internal primer named FBZRCQ.
The external and the internal primer alignments for vampire bat specific RABV variant detection. (a) Forward sequence of the external primer named VAMPIRORC. (b) Reverse sequence of the external primer named VAMPIROF. (c) Forward sequence of the internal primer named FBVFQ. (d) Reverse sequence of the internal primer named FBVRCQ.
The external and the internal primer alignments for nonhematophagous bat specific RABV variant detection. (a) Forward sequence of the external primer named MURCIELAGOF. (b) Reverse sequence of the external primer named MURCIELAGORC. (c) Forward sequence of the internal primer named FBMQ. (d) Reverse sequence of the internal primer named FBMRCQ.
The sequences and locations of the two pairs of variant-specific primers are listed in Table
All brain samples from Mexican host mammals were diagnosed as negative or positive in FAT, with a corresponding signal in the nested RT-PCR assay. A positive control for each variant was performed using a positive example previously MAbs tested. In the first step, the external amplification produced a single band of 608–1187 bp, while the second amplification of the primary PCR products with the internal primer showed products of 200–400 bp. To complement the nested information, one-step RT-PCR as well as the second nested RT-PCR was performed with external primers and the same samples (Figure
Mammals specific rabies virus variants detected by nested endpoint PCR assays. (a) Detection of dog specific variant (lines 2–4) and bat specific variant (lines 5–7). Lines 2 and 5: brain negative sample; lines 3 and 6: external amplification by RT-PCR (1187 and 668 pb, resp.); lines 4 and 7: internal amplification by nested PCR. (b) Detection of vampire bat specific variant (lines 2–4) and skunk specific variant (lines 7–9). Lines 2 and 7: brain negative sample; lines 3 and 8: external amplification by RT-PCR (835 and 795 pb, resp.); lines 4 and 9: internal amplification by nested PCR; line 5: empty. Lines 1 in (a) and 1 and 6 in (b) correspond to 100 pb DNA-ladder.
The optimal annealing temperature for external RT-PCR was in the range 48–55°C and was 56°C in the case of nested RT-PCR. Optimal concentration of Mg2+ was in the order of 2.5–3 mM for both RT-PCR and nested RT-PCR reaction mixtures.
For real-time RT-PCR assay, we used the internal primers (Table
Specific rabies virus variants detected by real-time RT-PCR assays. (a) Bat specific variant. (b) Dog specific variant. (c) Vampire bat specific variant. (d) Skunk specific variant.
A total of twenty-three samples were assessed as follows: nine negative-control samples performed by nested or real-time RT-PCR assays showed no positive detection with the internal and external primers; previously, fourteen positive-RABV variants samples were tested by FAT; eleven of them were categorized with monoclonal antibodies resulting in six positive to variant 1 (V1), three to V8, one to V5, two atypical variants, and two undetected. The RABV specific variant characterizations to dog, vampire bat, nonhematophagous bat, and skunk were determined by real-time RT-PCR using external primers. However, to prevent cross-reaction and to increase sensitivity in the nested PCR, internal primers were used to confirm thus the abovementioned variants. In addition, real-time PCR detection using internal primers confirmed the reservoir variant with dissociation temperatures of 60°C. The amplified fragments were sequenced with a subsequent analysis by BLAST; this analysis confirmed the reservoir for nested PCR and real-time RT-PCR (Table
Comparison between different methods of rabies virus variants detection.
Sample | Host | FAT | Antigenic variant | External RT-PCR | Internal PCR | SYBR Green | GenBank sequence | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
D | V | B | S | d | v | b | s |
|
|
|
|
|||||
1 | Dog 0068 | + | V1 |
|
|
|
|
|
|
|
|
|
|
|
|
JQ037820 |
2 | Dog 647 | + | V1 |
|
|
|
|
|
|
|
|
|
|
|
|
JQ037819 |
3 | Dog 659 | + | V1 |
|
|
|
|
|
|
|
|
|
|
|
|
JQ037823 |
4 | Dog 748 | + | V1 |
|
|
|
|
|
|
|
|
|
|
|
|
JQ037821 |
5 | Dog 2293 | + | V1 |
|
|
|
|
|
|
|
|
|
|
|
|
JQ037824 |
6 | Dog 885 | + | V1 |
|
|
|
|
|
|
|
|
|
|
|
|
JQ037822 |
7 | Cow 658 | + | V8 |
|
|
|
|
|
|
|
|
|
|
|
|
JQ037825 |
8 | Cow 2688 | + | V8 |
|
|
|
|
|
|
|
|
|
|
|
|
JQ037826 |
9 | Bat nonhematophagous 757 | + | A |
|
|
|
|
|
|
|
|
|
|
|
|
JQ037830 |
10 | Bat nonhematophagous 1594 | + | V5 |
|
|
|
|
|
|
|
|
|
|
|
|
JQ037829 |
11 | Bat nonhematophagous 1079 | + | None |
|
|
|
|
|
|
|
|
|
|
|
|
JQ037831 |
12 | Vampire bat 3919 | + | None |
|
|
|
|
|
|
|
|
|
|
|
|
JQ037827 |
13 | Vampire bat 110 | + | Atypical |
|
|
|
|
|
|
|
|
|
|
|
|
JQ037828 |
14 | Skunk 1369 | + | V8 |
|
|
|
|
|
|
|
|
|
|
|
|
JQ037818 |
15 | 65EDOMEXDOG05 |
|
NA |
|
|
|
|
|
|
|
|
|
|
|
|
— |
16 | 543EDOMEXDOG05 |
|
NA |
|
|
|
|
|
|
|
|
|
|
|
|
— |
17 | 642EDOMEXDOG05 |
|
NA |
|
|
|
|
|
|
|
|
|
|
|
|
— |
18 | 223EDOMEXDOG05 |
|
NA |
|
|
|
|
|
|
|
|
|
|
|
|
— |
19 | 1001EDOMEXDOG05 |
|
NA |
|
|
|
|
|
|
|
|
|
|
|
|
— |
20 | 455EDOMEXDOG05 |
|
NA |
|
|
|
|
|
|
|
|
|
|
|
|
— |
21 | 755EDOMEXDOG05 |
|
NA |
|
|
|
|
|
|
|
|
|
|
|
|
— |
22 | 2187EDOMEXDOG05 |
|
NA |
|
|
|
|
|
|
|
|
|
|
|
|
— |
23 | Negative control |
|
NA |
|
|
|
|
|
|
|
|
|
|
|
|
— |
FAT: fluorescent antibody test; Varian antigenic test: V1, dog; V5,
Twenty-three brain samples were analyzed as follows: nine negative-control samples and fourteen positive samples were confirmed by nucleotide sequencing. Regarding the results of the nested PCR and real-time PCR assays of the brain samples, they showed 100% sensitivity (100% CI: 76.84% to 100.00%) and 100% specificity (100% CI: 66.37% to 100%).
In some studies of antigenic characterization of rabies virus, a panel of eight anti-N protein monoclonal antibodies (MAbs) has been used, which can differentiate between eleven distinct variants harbored by a variety of terrestrial and chiropteran hosts [
Real-time RT-PCR techniques have been used for diagnosis and genotyping of all the
The real-time RT-PCR detection with SYBR Green, where the specificity is being given by the primers, is an easy-to-use assay to detect infected brain material in a single tube test and, consequently, is an attractive option for laboratory use as a screening surveillance tool. In the present study, these latest technologies for typing the RABV variants depending on the host (vampire bat, skunk, dog, and bat) were used.
The real-time RT-PCR detection with SYBR Green, whose specificity is given by the primers, is an easy-to-use assay to detect infected brain material in a single tube test and, consequently, is an attractive option for laboratory use as a screening surveillance tool. In the present study, these latest technologies for typing the RABV associated variants on the host (vampire bat, skunk, dog, and bat) were used.
In the design with highly specific primers from the conserved region from the nucleoprotein of RABV, the maximum average entropy (Hx) was in the order of 0.03–0.19 and the maximum entropy of each position was 0.97–0.99. In addition, the positions of different primers in N gene sequence are close but different for variant host, increasing the specificity.
The current gold standard test has been and is the fluorescent antibody test (FAT), which uses a conjugated monoclonal antibody against the RABV nucleoprotein. Although it is cheaper, some laboratories have no access to MAbs but have PCR and/or real-time technology.
In the characterization of the antigenic variants (AgV) with MAbs in the dog samples, the dog variant-specific primers identified the dog variant (V1). This result matched both the nRT-PCR and SYBR Green primers at 100%. Similarly, the skunk samples matched the same percentage with skunk variant-specific primers. Furthermore, in the bovine samples where the MAbs detection identified the skunk variant (V8), the determined host by nRT-PCR and SYBR Green was diagnosed as positive with the vampire primers, with this last result confirmed by sequences and AC Numbers JQ037818 to JQ037831 (Table
The MAbs detection in nonhematophagous bat was V5 bat, a result which coincides with both nRT-PCR and SYBR Green with the bat primer. The vampire bat 110 sample was determined as atypical and the vampire bat 3919 was not determined with the MABs; however, both samples were diagnosed as positive with the bat primers for nRT-PCR and SYBR Green.
In some cases, the classification of certain rabies virus isolates by monoclonal panel can obtain nontypical reactivity patterns and is not assigned to any known variant, as found in certain Argentinian rabies viruses [
In the hematophagous bat samples determined as atypical and the one not determined with the MAbs, it was concluded that the host was a vampire bat by nRT-PCR and SYBR Green detection. This may have occurred due to the high sensitivity of the RT-PCR molecular technique, as it has been shown in studies where positive results in brains analysis were demonstrated by nRT-PCR and negative results by FAT [
According to the RABV variant detection, the external primers and internal primers detect a specific variant and do not present cross-reaction between them, and the final result is given for the internal primer reaction in nested and/or RT-PCR real time, as they were obtained in different samples (Table
Test results interpretation of nested RT-PCR.
Rabies variant detection/primer name | VAMPIROF-VAMPIRORC | FBVFQ-FBVRCQ |
PERROF-PERRORC | FBPFQ-PERRORC |
MURCIELAGOF-MURCIELAGORC | FBMFQ-FBMRCQ |
ZORRILLOF-ZORRILLORC | ZORRILLOF-FBZRCQ |
---|---|---|---|---|---|---|---|---|
Vampire bat |
|
|
|
|
|
|
|
|
Dog |
|
|
|
|
|
|
|
|
Bat |
|
|
|
|
|
|
|
|
Skunk |
|
|
|
|
|
|
|
|
Only a sample can be considered positive if the result with the internal primers is positive regardless of the outcome of the external primers,
In addition, this study showed 100% sensitivity and 100% specificity assessed by nRT-PCR and real-time RT-PCR with SYBR Green. These findings are an early estimate by what is required of a greater number of related studies, increasing the number of samples to obtain better sensitivity and specificity evaluation. However, this assay could be useful, for institutions without access to MAbs and those that have PCR and/or real-time technology as an alternative.
The relevance of the present study falls in the rabies virus typing from original host-brains samples and the association with the variant-specific host performed by nested endpoint PCR or real-time RT-PCR assays. Previous studies report the detection in decomposed brains from dogs and humans samples [
The sequence obtained for this study, a splitting between the urban rabies (dog) and the sylvan rabies (bat, vampire bat, and skunk), was shown in Tables
This study describes the development of an alternative tool for RABV typifying in real-time RT-PCR and/or nested RT-PCR, considering dog, skunk, vampire bat, and nonhematophagous bat specific variants.
The authors declare that they have no competing interests.
The authors would like to acknowledge Lizdah Ivette García Rodríguez and José A. Valdes-Zúñiga, Unidad de Enseñanza, Investigación y Calidad, for supporting the administrative project permission and formats, IPN: COFAA SIP.