MicroRNAs (miRNAs) are a class of small noncoding RNA that, through mediating posttranscriptional gene regulation, play a critical role in nearly all biological processes. Over the last decade it has become apparent that plant miRNAs may serve as a novel functional component of food with therapeutic effects including anti-influenza and antitumor. Rapeseed bee pollen has good properties in enhancing immune function as well as preventing and treating disease. In this study, we identified the exogenous miRNAs from rapeseed bee pollen in mice blood using RNA-seq technology. We found that miR-166a was the most highly enriched exogenous plant miRNAs in the blood of mice fed with rapeseed bee pollen, followed by miR-159. Subsequently, RT-qPCR results confirmed that these two miRNAs also can be detected in rapeseed bee pollen. Our results suggested that food-derived exogenous miRNAs from rapeseed bee pollen could be absorbed in mice and the abundance of exogenous miRNAs in mouse blood is dependent on their original levels in the rapeseed bee pollen.
MicroRNAs (miRNAs) are a class of small noncoding RNA that mediate posttranscriptional gene regulation by promoting cleavage or inhibiting translation of the target mRNA in plants or animals and play a critical role in nearly all biological processes, including metabolism and immune functions [
Recent studies suggest that plant miRNA may serve as a novel functional component of food which makes a critical contribution to maintaining and shaping animal body structure and function [
Studies have shown that food-derived plant miRNAs have immunomodulating effects such as anti-influenza virus and antitumor [
Rapeseed (
In this study, ICR mice were fed with rapeseed bee pollen, and then plant miRNAs including rapeseed miRNAs in mice blood were detected using next-generation sequencing technology.
The rapeseed bee pollen was bought from Bee Research Institute of Anhui Agriculture University. The implementation of the standard is GB/T11758-89-bee pollen. Single pollen rates are over 95%, and the production date was November 10, 2015.
All animal experiments were performed using male ICR strain mice on a 12 h light/dark cycle in a pathogen-free animal feeding facility at Zhejiang Academy of Traditional Chinese Medicine. The animal study protocols were approved by the Animal Care and Use Committee of Zhejiang Academy of Traditional Chinese Medicine. At 6 weeks of age (weighted
The sequencing procedure was conducted according to standard steps provided by Illumina company, Inc. Briefly, a pair of adaptors were ligated to the 3′ and 5′ ends of total RNA. Reverse transcription followed by PCR is used to create cDNA constructs based on the small RNA ligated with 3′ and 5′ adapters. This process selectively enriches those fragments that have adapter molecules on both ends. Then the fragments of around 147–157 bp (22–30 nt length small RNA + adaptors) were purified by PAGE. The purified DNA was directly used for the cluster generation and sequencing using Illumina Hiseq2500 according to the manufacturer’s instructions. The image files generated by the sequencer were then processed to produce digital data. The subsequent procedures included removing adapter dimers, junk, low complexity, common RNA families (rRNA, tRNA, snRNA, and snoRNA), and repeats. Subsequently, unique sequences with length in 18–26 nucleotides were mapped onto all plant miRNA precursors in miRBase 20.0 by BLAST search to identify known miRNAs and novel 3p- and 5p-derived miRNAs. Length variation at both 3′ and 5′ ends and one mismatch inside of the sequence were allowed in the alignment. The unique sequences mapping onto specific species mature miRNAs in hairpin arms were identified as known miRNAs. The unique sequences mapping onto the other arm of known specific species precursor hairpin opposite to the annotated mature miRNA-containing arm were considered to be novel 5p- or 3p-derived miRNA candidates.
Total RNA was extracted from 80 mg rapeseed bee pollen using Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. Quantitative RT-PCR was performed using Taqman miRNA probes (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. To calculate the absolute expression levels of target miRNAs, a series of synthetic miRNA oligonucleotides at known concentrations were reverse transcribed and amplified. The absolute amount of each miRNA was then calculated with reference to the standard curve. Quantitative PCR was performed using an ABI-StepOnePlus machine (Applied Biosystems).
Differences are considered statistically significant at
We sequenced a small RNA library from blood RNA of mouse fed with rapeseed bee pollen using the Illumina Hiseq2500 system. We acquired a total of 11,089,480 raw sequences. Overview of these reads from raw data to cleaned sequences is shown in Table
Overview of reads.
Lib | Type | Total | % of total | Unique | % of unique |
---|---|---|---|---|---|
Raw reads | Nuclear acid | 11,089,480 | 100.000 | 209,873 | 100.000 |
3ADT & length filter | 320,992 | 2.895 | 145,808 | 69.474 | |
Junk reads | 858 | 0.008 | 610 | 0.291 | |
Rfam | RNA | 47,589 | 0.429 | 6,477 | 3.086 |
mRNA | RNA | 3,694 | 0.033 | 905 | 0.431 |
Repeats | RNA | 369 | 0.003 | 74 | 0.035 |
rRNA | RNA | 19,901 | 0.179 | 2,026 | 0.965 |
tRNA | RNA | 15,176 | 0.137 | 2,527 | 1.204 |
snoRNA | RNA | 5,507 | 0.050 | 750 | 0.357 |
snRNA | RNA | 527 | 0.005 | 243 | 0.116 |
Plant miRNA | RNA | 221 | 0.002 | 33 | 0.016 |
Another Rfam RNA | RNA | 6,478 | 0.058 | 931 | 0.444 |
Clean reads | 10,716,785 | 96.639 | 56,136 | 26.748 |
We illustrated small RNA reads with Rfam dataset; to remove rRNA, scRNA, snoRNA, snRNA, and tRNA, the pie charts were drawn for total reads and unique reads (Figure
Pie chart of sequence category. (a) Pie chart of sequence category of total reads. (b) Pie chart of sequence category of unique reads.
After removing the junk reads, the clean reads yield 34 plant miRNAs (Table
Plant miRNAs in mice fed with rapeseed bee pollen.
miRNA ID | miRNA sequence | Length (nt) | Frequency |
---|---|---|---|
bna-miR-166a | TCGGACCAGGCTTCATTCCCC | 21 | 35 |
bna-miR-159 | TTTGGATTGAAGGGAGCTCTA | 21 | 22 |
gma-miR6300 | GTCGTTGTAGTATAGTGGT | 19 | 8 |
nta-miR6145e | ATTGTTACATGTAGCACTGGCT | 22 | 7 |
nta-miR6146b | TTTGTCCAATGAAATACTTATC | 22 | 6 |
nta-miR6020b | AAATGTTCTTCGAGTATCTTC | 21 | 5 |
nta-miR6149a | TTGATACGCACCTGAATCGGC | 21 | 5 |
ath-miR-166a | TTCGGACCAGGCTTCATTCCCC | 22 | 3 |
osa-miR530 | TGCATTTGCACCTGCACCTCC | 21 | 3 |
ahy-miR408 | TGCACTGCCTCTTCCCTGGCT | 21 | 3 |
mdm-miR408a | TGCACTGCCTCTTCCCTGGCT | 21 | 3 |
bna-miR397a | ATTGAGTGCAGCGTTGATG | 19 | 2 |
peu-MIR2916 | CAACCATAAACGATGCCGACCAGG | 24 | 2 |
nta-miR168a | TCGCTTGGTGCAGGTCGGGAC | 21 | 2 |
gma-miR482b | TCTTCCCTACACCTCCCATACC | 22 | 2 |
nta-miR482a | TTTCCAATTCCACCCATTCCTA | 22 | 2 |
nta-miR827 | TTAGATGAACATCAACAAACA | 21 | 2 |
ppt-miR894 | TTCACGTCGGGTTCACCA | 18 | 2 |
gma-miR3522 | TGAGACCAAATGAGCAGCTGA | 21 | 2 |
gma-miR4996 | TAGAAGCTCCCCATGTTCTCA | 21 | 2 |
bna-miR403 | TTAGATTCACGCACAAACTCG | 21 | 1 |
peu-MIR2916 | ACCGTCCTAGTCTCAACCATA | 21 | 1 |
aau-miR162 | TCGATAAACCTCTGCATCCAG | 21 | 1 |
bdi-miR398a | TATGTTCTCAGGTCGCCCCTGT | 22 | 1 |
gma-miR403a | TTAGATTCACGCACAAACTT | 20 | 1 |
gma-miR1507a | TCTCATTCCATACATCGTCTGA | 22 | 1 |
nta-miR6159 | TAGCATAGAATTCTCGCACCTA | 22 | 1 |
hbr-miR6173 | GCTGTAAACGATGGATACT | 19 | 1 |
ptc-miR6478 | CCGACCTTAGCTCAGTTGGT | 20 | 1 |
stu-miR7997c | TTGCTCGGATTCTTCAAAAAT | 21 | 1 |
bna-miR156b | TTGACAGAAGATAGAGAGCAC | 21 | 1 |
gma-miR166m | GCGGACCAGGCTTCATTCCCC | 21 | 1 |
stu-miR399a | GGGCTACTCTCTATTGGCATG | 21 | 1 |
bna-miR156a | TGACAGAAGAGAGTGAGCAC | 20 | 1 |
Based on the predominant two miRNAs (miR-166a and miR-159) in the blood, we assumed that miR-166a and miR-159 can be found in rapeseed bee pollen, and the content of miRNAs in the rapeseed pollen also will follow the trend in the serum. To confirm this, the levels of miR-166a and miR-159 in rapeseed bee pollen were assessed by stem-loop quantitative reverse transcription polymerase chain reaction (RT-qPCR) assay. As a result, miR-166a and miR-159 can be detected in RNA of rapeseed bee pollen (Additional Figure 1 in Supplementary Material available online at
Given that miR-166a is the highest abundance rape-encoded miRNA in mice fed with rapeseed bee pollen, and it is rich in rapeseed bee pollen, we speculate that the miR-166a in mouse serum are mainly absorbed from rapeseed bee pollen. To test this speculation, we compared the abundance level of miR-166a in serum of mice fed with rapeseed bee pollen and control. As it is reported that the levels of plant-based miRNAs were elevated in serum of mice for 6 h [
The abundance levels of miR-166a in mouse serum after feeding with rapeseed bee pollen or chow diet for 6 h (
An estimated 60% of all protein-coding genes are targeted by miRNAs in human [
Bee pollen is rich in nutrition and medicinal composition, which ensued a wide use of bee pollen in food, health products, medicine, cosmetics, and other fields [
In this study, we confirmed that miRNAs from rapeseed bee pollen can be absorbed by mice, and the abundance of exogenous miRNAs in mouse blood is dependent on their original levels in pollen. Moreover, the detailed functions of these exogenous miRNAs in mammals should be investigated to help clarify the immune function or medical efficacy of bee pollen. Nevertheless, the present study provided first hand evidence for the potential usages of rapeseed bee pollen as a supplement of plant miRNAs.
The authors declare that they have no competing interests.
This work was funded by the Zhejiang Provincial Natural Science Foundation of China (LQ13C170002) and Zhejiang Provincial Science and Technology Department’s Foundation (2013F10001).