The goal of the present work was to investigate the relationship between
In many cases dental implant therapy requires bone regeneration procedures through bone graft materials. In fact, the lack of dentoalveolar bone can disallow the therapy by compromising primary implant stability [ A “natural” healing mechanism, in which inflammatory cells behavior can be modulated to result in an advantageous biological local environment. New bone ingrowth into the defect site, which should penetrate and replace the graft enabling the optimal balance between form and function.
While most of the published papers on bone regeneration through graft materials involve bone cells behavior and new bone formation, inflammatory response at the implant site and its correlation with bone formation and resorption should also be investigated. There is indeed an increasing literature about osteoimmunology, namely, the cross talk between cells from the immune and skeletal systems [
Since there are many shared molecular signaling pathways, bone balance (and increased bone formation) is influenced also through the modulation of inflammatory response to implant materials and devices. Very few papers describe more in detail inflammatory cell behavior and response upon contact with bone fillers in terms of gene and protein expression: Lange et al. [
The goal of the present work was to investigate the relationship between
In the present study, SB behavior is gauged against the widely used xenograft (bovine derived hydroxyapatite) Bio-Oss (from Geistlich Biomaterials). The latter is clinically considered the golden standard for periodontal and dentoalveolar surgery during bone augmentation procedures and owes its properties to the scaffolding effect prompted by the microarchitecture of the pristine bovine bone tissue [
The following materials were tested: Synthetic bone filler (SB) based on 25% hydroxylapatite-75% Bio-Oss, xenograft from bovine bone, 0.25–1 mm granule size, which was obtained from Geistlich.
Both materials were sterile, supplied in sealed vials containing 0.5 g of granulate material.
The expression of cytokines and other inflammatory markers was assessed using the real time reverse transcription polymerase chain reaction (qRT-PCR).
In particular, granulated samples were layered on the bottom of sterile 12-well polystyrene culture plates (12-well multiwell plates, Cell Star, Greiner One
A suspension of
As for SaOS-2 osteoblasts cells total RNA was extracted after 24 h, 72 h, and 7 days. A suspension of
Then total RNA was used as a template for cDNA synthesis using random hexamers as primer and Multiscribe Reverse Transcriptase (High Capacity cDNA RT Kit from Life Technologies).
cDNA amplification and relative gene quantification were performed using commercially available TaqMan probe and primers from Life Technologies. Full information on the used primers is available in the producer web site. Real time PCR was performed in duplicate for all samples and targets on a Step-One Plus instrument (Life Technologies) using the software Step-One, version 2.2. PCRs were carried out in a total volume of 20
To normalize the content of cDNA samples, the comparative threshold (Ct) cycle method, consisting of the normalization of the number of target gene copies versus the endogenous reference gene GAPDH, was used. The Ct is defined as the fractional cycle number at which the fluorescence generated by the cleavage of the probe passes a fixed threshold baseline when amplification of the PCR product is first detected. For comparative analysis of gene expression, data were obtained by using the ΔCt method.
The sequences of the primers used are the following.
IL-1 IL-6: AGAAAAGAGTTGTGCAATGGCAATT, IL-10: CTGAGGCGCTGTCATCGATTTCTCC, TNF- MCP-1: GCTCAGCCAGATGCAGTTAACGCCC, COX-2: GGACTGGGCCATGGAGTGGACTTAA, MCSF: AAAGGATTCTATGCTGGGCACACAG, GAPDH: ATGACAATGAATACGGCTACAGCAA.
ALP: TACAAGCACTCCCACTTCATCTGGA, OPN: TGAGGAAAAGCAGAATGCTGTGTCC, RANKL: TATTTCAGAGCGCAGATGGATCCTA, OPG: GTGGTGCAAGCTGGAACCCCAGAGC, COX-2: GCTGGGCCATGGGGTGGACTTAAAT, mPGEs: CGGAAGAAGGCCTTTGCCAACCCCG, GAPDH: GGAGTCAACGGATTTGGTCGTATTG.
The rabbit model is widely used for evaluating articles intended for clinical implantation. The lateral condyle of the femur provides a cancellous bone site, which will mimic the bone sites of clinical use. Experiments involved 22 New Zealand White male rabbits, with a body weight range from 3.5 kg to 4.0 kg at implantation and age approximately 7.5 months at implantation, with a minimum acclimation period of 6 days, identified by ear tags. Ten rabbits were included in the 12-week group and 12 in the 26-week group.
The rabbits were weighed. For general anesthesia, each rabbit was injected intramuscularly with a mixture of ketamine hydrochloride and xylazine (34 mg/kg + 5 mg/kg) dosed at 0.6 mL/kg. A fentanyl patch (analgesic; 25
The surgical site was draped. Using sterile technique, the lateral aspect of the distal end of the femur over the lateral condyle was exposed through a routine surgical approach. Following exposure of the bone, an initial pilot hole was created, using a drill with an approximate 1.5 mm bit, in the lateral aspect of the femoral condyle. Using a power drill with an approximate 4 mm drill bit, the hole was enlarged to approximately 4 mm in diameter. The defect had an approximate depth of 10 mm. A SB sample was implanted in the right femoral condyle and a BS control sample was implanted in the left femoral condyle of each rabbit. The samples were placed in the bone defect to fill the void and remain flush with the cortical surface. The fascia and subcuticular layer were closed with 4-0 absorbable suture and the skin was closed with surgical staples. The day of implantation was designated as Day 0.
Each rabbit was moved to a recovery area and placed on a heat source. Each rabbit was monitored for recovery from the anesthetic. Once sternal recumbency was achieved, each rabbit was returned to its cage. Each rabbit received another injection of the analgesic buprenorphine (0.05 mg/kg) at approximately 6 hours after the first injection. On Days 1–3, another dose of enrofloxacin was administered at 10 mg/kg.
Rabbits were observed daily for general health. Wound clips were removed once incisions had healed. Body weights were recorded for all animals prior to implantation, weekly for the first 4 weeks, every 4 weeks thereafter, and prior to termination.
At 12 weeks after implantation, ten rabbits were arbitrarily selected for termination. The selected rabbits were weighed and each rabbit was euthanized with an intravenous injection of a sodium pentobarbital based euthanasia solution. The bone implant sites and adjacent muscle tissue were examined macroscopically and the observations were recorded. Any adverse observations at the implant sites were described. Each femur was dissected free and removed. Femurs were cut as appropriate to allow the fixative to penetrate the bone tissue for proper fixation. The femurs were placed in 10% neutral buffered formalin (NBF). At 26 weeks after implantation, the remaining twelve rabbits were similarly euthanized, examined, and processed.
After adequate fixation, the defect sites with implants in place were removed by making transverse cuts through the bone proximal and distal to each implant site, taking care not to disturb the sites themselves. Each bone section was labeled to indicate its original location. The implant sites were processed for and embedded in Technovit for Exakt procedures. One slide from each block was prepared as a transverse section of the bone through the length of the defect and stained with hematoxylin and eosin. The identity (animal number; left/right and implant site) of each bone section was maintained during processing. The slides were provided to a pathologist for histological evaluation.
Macroscopic observations of the implantation sites were described and compared between SB and BS sites. A pathologist conducted the microscopic evaluation of the bone implant sites. The bone implantation sites were evaluated for tissue response and cellular reactions (including inflammation). Cellular changes were graded according to severity (0–4) based on the scoring scheme in ISO 10993, Part 6, Annex E. Representative images of implant sites were taken to demonstrate the microscopic findings.
First, we evaluated the expression of several cytokines and inflammatory factors in J774A.1 macrophages by using a specific developed model of gene expression previously described [
Figure
Interleukin 1-beta and interleukin 6 expression of J774A.1 macrophage cells grown on SB granules for 4 h, 24 h, and 72 h. Fold expression value is normalized to the expression on BS (dashed-dotted line).
Interleukins are also implied in many signal pathways related to osteoclast differentiation: in particular IL-1
Figure
Gene expression of J774A.1 macrophage cells grown on SB granules for 4 h, 24 h, and 72 h. Fold expression value is normalized to the expression on BS (dashed-dotted line).
Not only are cytokines and inflammatory signals produced by immune cells, but also osteoblast cells participate in their expression and/or stimulation. For this reason, the same samples were analyzed with SaOS-2 osteoblast cells and the expression of several genes was evaluated. In particular, the following genes were considered: ALP (alkaline phosphatase), a typical osteogenic marker [
Figure
Gene expression of SaOS-2 osteoblast cells grown on SB granules for 24 h, 72 h, and 7 days. Fold expression value is normalized to the expression on BS (dashed-dotted line).
Figure
SB | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Rabbit number | 78887 | 77888 | 78890 | 78891 | 78992 | 78886 | 78889 | 78897 | 78893 | 78907 |
Inflammation |
0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Lymphocytes | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Plasma cells | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Macrophages | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 1 | 1 | 1 |
Giant cells | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 1 | 1 | 1 |
Necrosis | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Subtotal ( |
0 | 0 | 0 | 0 | 4 | 4 | 0 | 4 | 4 | 4 |
Neovascularization | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Fibrosis | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 1 | 1 | 1 |
Fatty infiltrate | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Subtotal | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 1 | 1 | 1 |
Total | 0 |
0 |
0 |
0 |
5 | 5 | 0 |
5 | 5 | 5 |
Group total | 2.5 | |||||||||
Traumatic necrosis | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Foreign debris | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Number of sites examined | 0 |
1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
|
||||||||||
BS | ||||||||||
|
||||||||||
Rabbit number | 78887 | 77888 | 78890 | 78891 | 78992 | 78886 | 78889 | 78897 | 78893 | 78907 |
Inflammation |
0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Lymphocytes | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Plasma cells | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Macrophages | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 1 |
Giant cells | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 1 |
Necrosis | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Subtotal ( |
4 | 4 | 4 | 4 | 0 | 4 | 4 | 4 | 4 | 4 |
Neovascularization | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Fibrosis | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 1 |
Fatty infiltrate | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Subtotal | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 1 |
Total | 5 | 5 | 5 | 5 | 0 |
5 | 5 | 5 | 5 | 5 |
Group total | 4.5 | |||||||||
Traumatic necrosis | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Foreign debris | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Number of sites examined | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
Microscopic evaluation after 12 weeks (20x objective). (a) Inflammatory cells and fibrosis surrounding the implant (SB) in the cortical area of the implant; (b) new bone has formed along the surface of the implant (SB) located in the medullary area of the defect without inflammation; (c) inflammatory cells and fibrosis surrounding the implant (BS) in the cortical area of the implant; (d) new bone has formed along the surface of the implant (BS) located in the medullary area of the defect without inflammation.
After 26 weeks of implantation (Figure
Microscopic evaluation after 26 weeks. (a) The majority of the granules (SB) are surrounded by trabecular bone in the bone marrow (2x objective); (b) granule of SB in the periosteum is surrounded by macrophages and there is a minimal thickening of the fibrous periosteum (20x objective); (c) the tissue response is prominent in the periosteum and cortical region of the implant (BS) (2x objective); (d) inflammatory cells and fibrosis surrounding the implant (BS) in the cortical area of the implant (20x objective).
Regeneration of bone defects results from an interplay of healing mechanisms, in which inflammatory cells behavior determines the biological local environment that supports new bone formation into the defect site. A recent work shows that the biomimetic approach adopted for the synthetic bone filler SB, by surface modification of ceramic particles through a type 1 collagen nanolayer, can promote more pronounced new bone formation as compared to conventional synthetic fillers, with a direct effect on osteogenic cells [
Considering cytokine expression by J774A.1 macrophages cultured on the tested materials, results, within the limits of this cell model, suggest first of all that both materials exert a very mild inflammatory response: cytokine expression is always comparable to that recorded on plain tissue culture polystyrene. An exaggerated cytokine expression could turn the peri-implant site into a proosteoclastogenic environment [
Importantly, data shown in Figure
Within this general result, data show that SB decreases the immediate inflammatory response of macrophages upon contact with granules and stimulates a different expression profile of cytokines compared to BS. One hypothesis could be that the monolayer of covalently linked collagen on the surface of the granules could act as a modulator of inflammatory response by mimicking the biological environment: this could lead to a decrease in the expression of proinflammatory signals and pathways related to the classical foreign body reaction. The overexpression of IL-10 on SB (Figure
The overall results on osteoblast cells demonstrate a rather similar response to the two materials. The increased expression of RANKL on SB is balanced by the same stimulation of the expression of osteoprotegerin: the RANKL/OPG ratio does not change; the higher expression recorded on SB could suggest increased bone remodeling activity. The enhancement of ALP expression at 72 hours is important because it could mean that cell differentiation is stimulated by SB, and they are induced to produce larger amount of mineralized bone, again in agreement with documented findings on collagen-coated bone-contacting devices [
At a more subtle level, the combined gene expression profile of macrophages and osteoblasts on SB suggests a different pathway for healing around SB as compared to BS implants: the decrease of the expression of the main proinflammatory cytokines, combined with the increase of the anti-inflammatory IL-10 in macrophage cells and the decrease of OPN expression together with the increase of ALP expression in osteoblasts, seems to stimulate a more appropriate inflammatory response to initiate a natural healing process and consequent new bone formation. This is understandable, because cells on SB do not face an inert material; rather they dialogue with the signaling cues of collagen type I.
The analysis of gene expression of several cytokines from simple
The understanding, as attempted in the present work, of the relevance of different profile of cytokine expression
The authors declare that they have no competing interests.