Microdissection is a useful method in tissue sampling prior to molecular testing. Tumor heterogeneity imposes new challenges for tissue sampling. Different microdissecting methods have been employed in face of such challenge. We improved our microdissection method by separately microdissecting the morphologically different tumor components. This improvement helped the pyrosequencing data analysis of two specimens. One specimen consisted of both adenocarcinoma and neuroendocrine components. When both tumor components were sequenced together for KRAS (Kirsten rat sarcoma viral oncogene homolog) gene mutations, the resulting pyrogram indicated that it was not a wild type, suggesting that it contained KRAS mutation. However, the pyrogram did not match any KRAS mutations and a conclusion could not be reached. After microdissecting and testing the adenocarcinoma and neuroendocrine components separately, it was found that the adenocarcinoma was positive for KRAS G12C mutation and the neuroendocrine component was positive for KRAS G12D mutation. The second specimen consisted of two morphologically different tumor nodules. When microdissected and sequenced separately, one nodule was positive for BRAF (v-raf murine sarcoma viral oncogene homolog B1) V600E and the other nodule was wild type at the BRAF codon 600. These examples demonstrate that it is necessary to microdissect morphologically different tumor components for pyrosequencing.
Microdissection has been used to obtain tumor tissue for molecular testing with the primary goal of separating tumor and normal tissue to increase the amount of tumor DNA and, therefore, increasing test sensitivity. Tumor heterogeneity imposes new challenges for tissue sampling. We need to microdissect tumor not only from normal tissue but also from different intratumor elements. Different methods have been used for microdissection [
Pyrosequencing is a sequencing technology that is more sensitive than Sanger sequencing [
Two separate specimens were examined for this study with distinctly different morphologies: Adenocarcinoma with neuroendocrine differentiation (specimen 1). Adenocarcinoma with two morphologically different nodules (specimen 2).
Specimen 1 consists of a 3-cm pulmonary nodule, containing adenocarcinoma and neuroendocrine components. The formalin fixed paraffin embedded (FFPE) tumor tissue sections were microdissected manually using two methods: one combining both adenocarcinoma and neuroendocrine components and the second separating the adenocarcinoma and neuroendocrine components. The three microdissected samples from specimen 1 were sequenced separately.
Specimen 2 consists of adenocarcinoma with two morphologically different pulmonary nodules. One tumor nodule is invasive adenocarcinoma, solid predominant type [
DNA was extracted from the microdissected tissue, using the QIAamp DNA FFPE Tissue Kit (Qiagen, Cat# 56404, Valencia, CA 91355, USA) and QiaCube instrument (Qiagen, Valencia, CA 91355, USA). The microdissected tissue was transferred into a 2 mL tube containing 180
Pyrosequencing for KRAS, EGFR, and BRAF mutation was performed according to the manufacturer’s instructions [
The targeted sequence for KRAS codons 12 and 13 is GGTGGCGTAGG and the dispensing order is ACTGTACGTGATCGTAGCA (Figure
Six pyrograms, panels (a, b, c, d, e, and f), are present. The
H&E stain of two specimens is shown. Panel (a) shows the glandular tumor component from specimen 1. Panel (b) shows the neuroendocrine tumor component from specimen 1. Panel (c) shows an invasive adenocarcinoma, solid predominant, poorly differentiated tumor, from specimen 2. Panel (d) shows the minimally invasive adenocarcinoma, nonmucinous type, from specimen 2.
The targeted sequence for BRAF codon 600 is CTAGCTACAGTG. The sequence primer for BRAF codon 600 is also a reverse primer; therefore the pyrosequencing reading for BRAF is the reverse complement of the targeted sequence, CACTGTAGCTAG. The dispensing order is TCGTATCTGTAG (Figure
EGFR exons 18, 19, 20, and 21 were also sequenced (data not shown). The targeted sequences were GGCTCCGGTGC (exon 18), TATCAAGGAATTAAGAGAAGCAACATCTCCGAAAG (exon 19), CAGCGTGG and ATCACGCAG (exon 20, codons 768 and 790), and CTGGCCAAACTGCTGGGT (exon 21) respectively. The dispensing orders for EGFR exons are CATGTCACTCGTG (for exon 18), CTATCACTGTCAGCTCGATCGTCATCGTCACGC (for exon 19), GCAGTACGTGTCGTGTACGTGACCACACTG and GATCATCTG (for exon 20, codons 768 and 790 resp.), and ACGTGTCACATGTC (for exon 21).
The tumor morphology of specimen 1 is shown in Figures
The pyrosequencing result of the entire tumor from specimen 1, including both adenocarcinoma and neuroendocrine components, is shown in Figure
Specimen 2 consists of two tumor nodules, invasive adenocarcinoma, solid predominant type [
Tumor heterogeneity has been previously recognized and vigorously studied. The heterogeneity involves different levels of tumor clonal evolution, including cellular morphology, gene mutations, and biological responses to therapies [
Specimen 1 consists of adenocarcinoma and neuroendocrine components. Morphologically, the two components are intermingled in some areas of the tumor but are distinct in other areas of the tumor (Figures
In Figure
Specimen 2 consists of two morphologically different tumor nodules, an invasive adenocarcinoma, solid predominant type [
In current pathology practice, both small specimen size and tumor heterogeneity complicate the sampling process, indicating an increasing need for different microdissecting methods. A microdissection of different tumor components, as discussed in this report, addresses a portion of the difficulties in tissue sampling. This approach works when the heterogeneous components are morphologically different. Different methods have been and are still being developed to address different aspects of the tissue sampling issue. For example, microdissecting heterogeneous tumor components based on immunohistochemical phenotypes has been recently reported [
Different methods of microdissecting have improved the quality of clinical molecular testing and have a direct impact on patient care as indicated by the results from specimen 1. This specimen was an invasive adenocarcinoma with neuroendocrine differentiation. At the beginning, the entire tumor was microdissected altogether and the result was not interpretable. The puzzle was not resolved until the two tumor components were microdissected and tested separately. Then it became clear that two components bear different KRAS mutations.
Specimen 2 is an example that microdissecting different tumor components may have impact on patient management. This case presents two tumor nodules of different morphology. One was an invasive adenocarcinoma, solid predominant type, and the second nodule was a minimally invasive adenocarcinoma. The former was positive for BRAF V600E mutation and the latter was wild type for BRAF. Treatment for tumors with or without BRAF mutation could be different. Microdissecting and testing each tumor component separately can provide more precise mutation information for the patient’s personalized management.
The authors declare that they have no competing interests.
The authors thank Mike Gruidl, Ph.D., for reviewing and editing the paper.