Platelets (PLTs) are produced by megakaryocytes (MKs) that completed differentiation and endomitosis. Endomitosis is an important process in which the cell replicates its DNA without cytokinesis and develops highly polyploid MK. In this study, to gain a better PLTs production, four small molecules (Rho-Rock inhibitor (RRI), nicotinamide (NIC), Src inhibitor (SI), and Aurora B inhibitor (ABI)) and their combinations were surveyed as MK culture supplements for promoting polyploidization. Three leukemia cell lines as well as primary mononuclear cells were chosen in the function and mechanism studies of the small molecules. In an optimal culture method, cells were treated with different small molecules and their combinations. The impact of the small molecules on megakaryocytic surface marker expression, polyploidy, proliferation, and apoptosis was examined for the best MK polyploidization supplement. The elaborate analysis confirmed that the combination of SI and RRI together with our MK induction system might result in efficient ploidy promotion. Our experiments demonstrated that, besides direct downregulation on the expression of cytoskeleton protein actin, SI and RRI could significantly enhance the level of cyclins through the suppression of p53 and p21. The verified small molecule combination might be further used in the in vitro PLT manufacture and clinical applications.
Platelets (PLTs) are a component of blood, which plays an important role in hemostasis, wound healing, inflammation, and thrombosis [
Hematopoietic stem cells differentiate to megakaryocytes and release of platelets under the influence of the bone marrow microenvironment. During megakaryocyte differentiation and maturation, the cells would increase their DNA content, cytoplasm volume, and surface area of membrane. The large size and abundant cytoplasm eventually promote the release of a large number of platelets. In normal bone marrow, megakaryocytes form up to 128N polyploid compared to no more than 16N ploidy from in vitro cell culture, and most cells stayed at the 2N and 4N stage after tissue culture [
Considering the importance of megakaryocyte polyploidy in platelet generation, exploring the mechanism under megakaryocyte polyploidization became one of the hotspots in the field. It is suggested that endomitosis without anaphase B, as well as the blockage of cytokinesis, results in megakaryocyte polyploidization. Four cytokinesis inhibitors, including Rho-Rock inhibitor (RRI, Y27632), nicotinamide (NIC, vitamin B3), Src inhibitor (SI, Su6656), and Aurora B kinase inhibitor (ABI, ZM447439), were chosen to increase the polyploidization output during megakaryocyte induction in vitro [
The following regents were used: Annexin V-FITC/PI Apoptosis Detection Kit (Dojindo, Japan); phorbol 12-myristate 13-acetate (PMA), nicotinamide, and RPMI-1640 medium (Sigma America); Rho-Rock inhibitor (Stemgent America); Src inhibitor and Aurora B kinase inhibitor (Millipore America); PE-antiCD41 and APC-antiCD61 antibodies (eBioscience America); anti-p21, anti-p53, and anti-cyclin B1 antibodies (Santa Cruz, America); anti-
Mononuclear cells (MNCs) were isolated from fresh human umbilical cord blood after the delivery of normal pregnancies with patient’s informed consent. MNCs were applied to density centrifugation at 700
The human leukemia K562, MEG-01, and UT-7 cells were cultured in RPMI-1640 medium supplemented with 10% FBS. Recombinant human erythropoietin (EPO, 1 IU/ml) was added to the medium for UT-7 cell maintenance. To induce megakaryocytic differentiation, cells were seeded at 2 × 105 cells/ml and cultured and treated with PMA.
Cells were collected and washed with PBS and then permeabilized with 70% cold methanol for 1 hour at 4°C or preserving at −20°C. Propidium iodide (50
Cells were rinsed in PBS, cytocentrifuged onto glass slides, stained with Wright–Giemsa solution (Sigma), and then observed by light microscopy (NIKON, Japan). NIS-Elements F software was used to capture picture and measure cell diameter. Over 50 cells from five random views were measured. Dunnett’s
The K562 and MEG-01 cells were treated with PMA (0.625 ng/ml) for 3 days and then with PMA (10 ng/ml) with or without different small molecules. The cells were cultured by the concentration of 2 × 104 in 96-well plate (100
Cells were lysed and total RNA was isolated by Trizol Reagent (Invitrogen, America), followed by reverse transcription of 1
Primer sequence.
Gene | Primer sequence (5′-3′) | Annealing temperature (°C) |
---|---|---|
Cyclin B1 | F: AATAAGGCGAAGATCAACATGGC | 58 |
R: TTTGTTACCAATGTCCCCAAGAG | ||
Cyclin D1 | F: GCTGCGAAGTGGAAACCATC | 58 |
R: CCTCCTTCTGCACACATTTGAA | ||
Cyclin E1 | F: GCCAGCCTTGGGACAATAATG | 58 |
R: CTTGCACGTTGAGTTTGGGT | ||
p21 | F: TGTCCGTCAGAACCCATGC | 58 |
R: AAAGTCGAAGTTCCATCGCTC | ||
p53 | F: CCCCTCCTGGCCCCTGTCATCTTC | 58 |
R: GCAGCGCCTCACAACCTCCGTCAT | ||
|
F: CATGTACGTTGCTATCCAGGC | 58 |
R: CTCCTTAATGTCACGCACGAT | ||
GAPDH | F: GAGTCAACGGATTTGGTCGT | 58 |
R: TTGATTTTGGAGGGATCTCG |
All results were replicated in three independent experiments. All statistics data are expressed as the mean ± SD. Statistical analysis was performed using the SPSS software (ver. 18.0 for Windows; SPSS, Chicago, IL). The groups of the culture methods in polyploidization and effects of several small molecules were analyzed by using ANOVA pairwise comparison. Two-Way ANOVA and LSD-
PMA was commonly used in induction of megakaryocyte differentiation from human leukemic cells, such as K562, MEG-01, and UT-7 cells in this study. After PMA treatment, the cells became larger and polyploid and expressed the MK markers CD41 and CD61 (Figure S2). To determine whether the selected small molecules could further improve polyploidization, we added small molecules to the culture medium after MK differentiation, respectively (Figure S3). The increase in cell size and ploidy levels after RRI, ABI, or SI treatment was evident in cytospin analysis (Figure
Effect of small molecules on MK polyploidization in megakaryocytic cells. (a) Morphological difference of the cells after treatment with small molecules was shown by Wright–Giemsa staining. Cell diameter of over 50 cells from five random views was measured (scale bars: 20
To make our result more convincing and reflect normal hematopoiesis, simultaneously, we examined the effects of small molecules on polyploidization in human MK progenitors (MK-PROs). Ploidy analysis by flow cytometry showed that the proportion of 4N cells and 8N cells by treated with SI (14.33%, 2.46%) or ABI (15.99%, 3.14%) was also significantly increased when compared with control (10.85%, 1.11%), which is consistent with previous observations. The proportion of 4N and 8N cells in NIC-treated cells increased but not significant. Besides, the proportion of 4N and 8N cells in RRI had no significant as well (Figure
Effect of small molecules on MK polyploidization in human MK progenitors (MK-PROs). (a) MK-PROs DNA ploidy analysis (4N and ≥8N) after different small molecules treatment. Representative flow cytometry plots are shown in the upper panel. Statistical analysis was made by comparing with the control group. (b) Morphology and cell diameter of MK-PROs after small molecules treatment for 10 days (scale bars: 50
To gain a better promotion of polyploidization, we further examined the effect of different combinations of small molecules in cell lines and MK-PROs. In cell lines, our results indicated that the addition of SI alone or with other small molecules (SI, SI + RRI and SI + RRI + NIC group) would significantly enhance the percentage of ploidy in all cells besides the combination of RRI, SI, and NIC in UT-7 cells. We considered that it might be because of the inhibited effect of NIC according to the result from NIC-treated alone. Treatment with RRI and SI combination had additive effect for polyploidization compared with SI alone in K562 (33.30% versus 29.17%) and MEG-01 cells (30.35% versus 28.72%). The combination of NIC, RRI, and SI increased polyploid relative to control group but was no better than the combination of RRI and SI in both K562 and UT-7 cells (Figure
The combination of small molecules for polyploidization in MKs. (a) Ploidy analysis by flow cytometry. Ploidy (≥8N) after the combination of small molecule treatment was compared with control in three megakaryocytic cells. Representative flow cytometry plots of RRI + SI treatment or control are shown in the lower panel. (b) Morphology of stained polyploid megakaryocytes in UT-7 cells treated with RRI and SI (scale bars: 20
In megakaryocyte polyploidization, the cell cycle-related protein and cytoskeletal proteins both play important role in MK endomitosis. It is suggested that G1 phase progression protein cyclin D1 and G1/S checkpoint protein cyclin E1 are both essential for DNA content enlargement and megakaryocyte polyploidy. Moreover, the maintenance of M phase protein cyclin B1 is required for G2 phase arresting and megakaryocyte endomitosis. As a consequence, the expression of cell cycle regulator cyclin D1, cyclin E1, and cyclin B1 under small molecule treatment was checked first to uncover the function of small molecules. Cyclin B1, cyclin D1, and cyclin E1 increased significantly by RRI and/or SI treatment in leukemic cells and MK-PROs by mRNA level. The additive effect of RRI and SI on cyclins expression was more profound in MK-PROs. Actin inhibition which might abrogate the actin cleavage furrow formation has been proved essential in the megakaryocyte polyploidization. It was also clear in our study that the expression of
Expression of cell cycle-related proteins and cytoskeletal proteins after RRI and SI treatment. (a) Expression of cyclin B1, cyclin D1 cyclin E1,
To figure out the direct connection between small molecules and cyclin regulation, key regulators of cyclin-CDK complex, CDK inhibitors (CKIs), and their upstream molecules were explored. Hints from the studies on RRI and SI in cell cycle regulating suggest that a crucial cell cycle regulator, p53, can be suppressed both by the two small molecules [
For a better platelet manufacture, the small molecules such as NIC, RRI, SI, and ABI have all been reported had positive effect on MK polyploidization [
Impact of four small molecules and their combinations on megakaryocyte maturation judged by K562, UT-7, MEG-01 cells, and primary MK progenitors (MK-PROs).
NIC | RRI | SI | ABI | RRI + SI | RRI + NIC | RRI + SI + NIC | |
---|---|---|---|---|---|---|---|
Cell diameter | — | ↑1 | ↑ | ↑2 | ↑ | ↑ | ↑3 |
DNA ploidy | —4 | — | ↑ | ↑ | ↑ | —5 | ↑ |
Proliferation | — | — | — | —6 | |||
CD61 expression7 | — | — | — | ↓ | ↑ | — | ↑ |
Apoptosis7 | ↑ | — | — | ↑ | — | ↑ | ↑ |
In K562, MEG-01, and UT-7 cells, RRI had no effect for ploidy, which was different from previous report [
Although RRI, SI, and ABI presented common effect on all the three cell lines we tested, treatment of NIC inhibited the polyploidization of UT-7 cells instead of showing no effect. We suspect that the UT-7 cells used in this study had been pretreated with EPO, an erythroid lineage inducer, and an antiapoptosis factor as well, while NIC could increase the expression of p53 and cause apoptosis [
In the mechanism studies, although initially the 4 small molecules were chosen based on their profound effect on cytokinesis, they have also been proved playing important roles in cell cycle regulation [
In conclusion, by using leukemia cell line megakaryocytic induction model, a small molecule combination was discovered as polyploidization promoter. The function of the combination was proved through downstream signal examination. Hopefully, the small molecules might contribute to in vitro platelet manufacture in a sooner future.
The authors declare that there are no conflicts of interest regarding the publication of this article.
Xiaojing Zou and Mingyi Qu contributed equally to this work.
This work was supported by Nature Science Foundation of China (nos. 31301199, 31401260, and 81301132) and Guangzhou Health Care and Cooperative Innovation Major Project (no. 201400000003).