Numerous studies have found that angiotensin II (Ang II) participates in podocyte apoptosis and exacerbates progression of end-stage kidney disease (ESKD). However, its underlying mechanism remains largely unexplored. As a homolog of Drosophila disabled (Dab) protein, Dab1 plays a vital role in cytoskeleton, neuronal migration, and proliferation. In the present study, our data revealed that Ang II-infused rats developed hypertension, proteinuria, and podocyte injury accompanied by Dab1 phosphorylation and increased reelin expression in kidney. Moreover, Ang II induced podocyte apoptosis in vitro. Dab1 phosphorylation and reelin expression in podocytes were increased after exposure to Ang II. Conversely, Dab1 small interfering RNA (siRNA) exerted protective effects on Ang II-induced podocyte apoptosis, resulting in decreased p38 phosphorylation and reelin expression. These results indicated that Dab1 mediated Ang II-induced podocyte apoptosis via p38 signaling pathway.
As terminally differentiated cells, podocytes play a crucial role in establishing the integrity and selective permeability of the glomerular filtration barrier [
Disabled-1 (Dab1), a homolog of the Drosophila disabled protein, consists of three main domains as follows: C-terminal serine/threonine-rich region, N-terminal protein interaction/phosphotyrosine binding domain, and a tyrosine-rich region. Dab1 located in cytoplasm is an adaptor protein associated with neuronal migration and polarization [
Our previous study has indicated that c-Abl upregulation promotes podocyte apoptosis upon exposure to Ang II via Akt signaling [
A total of 16 male specific-pathogen-free (SPF) Sprague-Dawley rats (weighing 110–140 g) were supplied by the Research Center of Medical Experimental Animals of Wuhan University. Animals were bred in an atmosphere with controlled temperature and humidity under an artificial light cycle. Food pellets and water were available ad libitum. Rats embedded with osmotic minipump (Alzet model 2002 or 2004, CA) were randomly subjected to normal saline infusion or Ang II infusion at a dose of 400 ng/kg/min for 4 weeks. Tail cuff plethysmography was used to measure systolic blood pressure at different time points (weeks 1, 2, 3, and 4). Rats were individually placed into metabolic cages for 24 h to collect urine, and urinary albumin was determined at the above-mentioned time points (weeks 1, 2, 3 and 4). Urinary albumin was determined with a competitive ELISA kit (Shibayagi, Shibukawa, Japan). Animals were sacrificed after 4 weeks. Part of the kidney was fixed in 4% phosphate-buffered paraformaldehyde for pathological analysis of renal damage, and the rest was stored at −80°C prior to further biochemical analysis. Glomeruli were isolated by 177
Conditionally immortalized mouse podocytes were kindly provided by Dr. Peter Mundel (Massachusetts General Hospital, Boston, MA). Podocytes were cultured in RPMI 1640 medium (HyClone, USA) supplemented with 10% heat-inactivated fetal calf serum (Gibco, USA), 100 U/mL penicillin G, 100 mg/mL streptomycin, and 10 U/mL recombinant murine interferon-
Dab1 siRNA transfection was carried out according to the HiPerFect Transfection Reagent Handbook (QIAGEN, Germany). Four Dab1 siRNAs (siRNA sequences: si1 AAGGGAGAACACAAACAGAAA, si3 CAGCGAAGCCACTTTGATAAA, si4 CACTTTGATAAAGAGGTTTAA) were designed and synthesized by QIAGEN (Germany). Briefly, 2 × 105 cells were seeded in a 6-well plate and then transfected with a 100
The cell climbing film was fixed in 4% paraformaldehyde at 4°C for 30 min and then blocked in 5% bovine serum albumin at room temperature for 30 min. The films were, respectively, stained with the following antibodies: Dab1 antibody (1 : 50, sc-13981, Santa Cruz Biotechnology), phospho-Dab1 antibody (1 : 25, sc-133293, Santa Cruz Biotechnology), and reelin antibody (1 : 50, sc-25346, Santa Cruz Biotechnology) at 4°C overnight. Subsequently, films were incubated with FITC-conjugated IgG as the secondary antibody at 37°C for 45 min in the dark. The sections were observed under fluorescence microscope (Olympus, Japan).
Paraffin-embedded sections were deparaffinized and treated with 3% H2O2 at room temperature for 30 min. Antigen retrieval for Dab1, phospho-Dab1, and reelin was carried out in high-pressure citrate buffer (0.01 M, pH 6.0) for 10 min. The sections were blocked with 5% bovine serum albumin for 30 min, incubated with nephrin antibody (1 : 100, sc-32529, Santa Cruz Biotechnology), Dab1 antibody (1 : 50, sc-13981, Santa Cruz Biotechnology), phospho-Dab1 antibody (1 : 30, sc-133293, Santa Cruz Biotechnology), and reelin antibody (1 : 50, sc-25346, Santa Cruz Biotechnology) at 4°C overnight, and then stained with FITC-conjugated IgG at 37°C for 60 min in the dark. All microscopic images were recorded using a fluorescence microscope (Olympus, Japan).
Podocyte apoptosis in kidney tissue was assessed by TUNEL (Roche, Germany) according to the manufacturer’s instructions. Briefly, the paraffin-embedded sections were dewaxed and incubated with 3% H2O2 for 30 min. Antigen retrieval was performed in high-pressure citrate buffer (0.01 M, pH 6.0) for 10 min. Subsequently, the sections were blocked with 10% goat serum at room temperature for 30 min and incubated with terminal deoxynucleotidyl transferase (TdT) and digoxigenin-11-dUTP at room temperature for 1 h. Next, sections were incubated with streptavidin-biotin-peroxidase-conjugated antidigoxigenin-11-dUTP antibody for 30 min. The negative control was omitted TdT. The podocytes were counted in 3 glomerular cross sections using 10 randomly selected fields. Two consecutive sections were stained with PAS and TUNEL, respectively. The sections were scanned by automatic digital slice scanning system (Leica SCN400F, Germany). Podocytes were identified and counted in PAS section [
Glomeruli and podocytes were lysed with RIPA buffer (Beyotime, China) containing protease inhibitor cocktail (Sigma-Aldrich) and PMSF (Beyotime, China) on the ice for 30 min, and then the cell lysates were centrifuged at 12,000 rpm for 10 min at 4°C. Subsequently, the supernatants were mixed with 5x loading buffer and boiled at 100°C for 5 min. The proteins were separated with SDS-PAGE and then electrotransferred onto PVDF membranes (Merck Millipore). The membranes were incubated with primary antibodies (rabbit polyclonal Dab1 antibody, 1 : 50, Santa Cruz Biotechnology, Dallas, TX; rabbit polyclonal phospho-Dab1 antibody, 1 : 50, Santa Cruz Biotechnology, Dallas, TX; mouse monoclonal reelin antibody, 1 : 50, Santa Cruz Biotechnology, Dallas, TX; rabbit polyclonal p38 antibody, 1 : 1,000, Cell Signaling Technology; rabbit polyclonal phospho-p38 antibody, 1 : 1,000, Cell Signaling Technology; rabbit polyclonal ERK antibody, 1 : 1,000, Cell Signaling Technolog; rabbit polyclonal phospho-ERK antibody, 1 : 1,000, Cell Signaling Technology; rabbit polyclonal caspase-3 antibody, 1 : 1000, GeneTex Inc.; rabbit polyclonal bcl-2 antibody, 1 : 1000, GeneTex Inc.; rabbit polyclonal
Data were presented as means ± SD and analyzed with SPSS 17.0. Student’s
Figure
Clinical and pathological changes. (a) Glomerular pathological changes with PAS staining (original magnification ×200, ×400); (A) control group in week 4; (B) Ang II-infused group in week 4. Scale bars, 50
Figure
Ang II increases reelin/Dab1 expression in kidney. (a) Double immunofluorescence staining for podocyte marker nephrin and various molecules (Dab1, phospho-Dab1, and reelin) in rat kidney (original magnification ×200); scale bars, 50
To investigate the effect of Ang II on the in vitro expression of reelin/Dab1, we assessed the reelin/Dab1 expression in cultured podocytes. Podocytes were treated with 10−6 M Ang II for several time points (0, 3, 6, 12, and 24 h) [
Ang II increases reelin/Dab1 expression in cultured podocytes and induces podocytes apoptosis. (a) Western blotting detected the expressions of phospho-Dab1, Dab1, and reelin in cultured podocytes treated by Ang II (10−6 M) at various time points. (b, c) Quantitative analysis of phospho-Dab1 and reelin expression. (d) Immunofluorescence staining of Dab1, phospho-Dab1, and reelin in cultured podocytes stimulated by Ang II (10−6 M) for 6 h (original magnification ×400); scale bars, 20
Podocytes were transfected with Dab1 siRNA to evaluate the role of Dab1 in Ang II-induced podocyte apoptosis. Figures
Knockdown of Dab1 diminishes Ang II-induced podocyte apoptosis. (a) Western blotting detected phospho-Dab1 and Dab1 expression in podocytes transfected with Dab1 siRNA. Scrambled siRNA represents a nonspecific nonsilencing siRNA. (b) Quantitative analysis of phospho-Dab1 and Dab1 expression. (c) Western blotting detected expressions of cleaved caspase-3 and bcl-2 in podocytes transfected with Dab1 siRNA in the presence or absence of Ang II. (d) Quantitative analysis of cleaved caspase-3 and bcl-2 expressions.
It is well known that p38 and ERK pathways participate in regulation of cellular proliferation, differentiation, apoptosis, and so on [
Knockdown of Dab1 affects the MAPK signaling pathway and reelin expression in Ang II-treated podocytes. (a) Western blotting detected phospho-P38, phospho-ERK, and reelin expression in the podocytes. (b–d) Quantitative analysis of phospho-P38, phospho-ERK, and reelin expression.
In the present study, we found that Ang II played an important role in the process of proteinuria and podocyte injury. Our previous studies have confirmed the effects of Ang II on podocyte apoptosis and albuminuria [
As a secreted glycoprotein, reelin is expressed in Cajal-Retzius cells and granule cells in the cerebellum and olfactory bulb [
In neural development, phospho-Dab1 promotes neuronal migration and regulates neuronal polarization via activating downstream Crk-C3G-Rap1-cadherin and PI3K-Akt signaling pathways [
We investigated the effects of Dab1 on the MAPK signaling pathway, which plays a vital role in regulation of cellular proliferation, differentiation, and apoptosis [
Our data showed that Dab1 and reelin could be expressed in rat kidney and cultured mouse podocytes. Podocytes and rats treated with Ang II displayed increased phospho-Dab1 and reelin expression. Ang II could induce apoptosis of cultured podocytes, and the knockdown of Dab1 by specific siRNA inhibited proapoptotic effects of Ang II. Furthermore, Dab1 contributed to Ang II-induced podocyte apoptosis via p38 signaling. Therefore, the Dab1-p38 signaling pathway might be a novel candidate therapeutic target in order to decrease podocyte apoptosis in chronic kidney diseases.
The authors declare that there are no conflicts of interest.
Zhao Gao and Xinghua Chen contributed equally to this work.
This work was financially supported by grants from the National Science Foundation of China (81500516 to Xinghua Chen and 81570617 to Guohua Ding) and the Natural Science Foundation of Hubei Province (2015CFB347 to Xinghua Chen).