Poor viability of engrafted bone marrow mesenchymal stem cells (BMSCs) often hinders their application for wound healing, and the strategy of how to take full advantage of their angiogenic capacity within wounds still remains unclear. Negative pressure wound therapy (NPWT) has been demonstrated to be effective for enhancing wound healing, especially for the promotion of angiogenesis within wounds. Here we utilized combinatory strategy using the transplantation of BMSCs and NPWT to investigate whether this combinatory therapy could accelerate angiogenesis in wounds. In vitro, after 9-day culture, BMSCs proliferation significantly increased in NPWT group. Furthermore, NPWT induced their differentiation into the angiogenic related cells, which are indispensable for wound angiogenesis. In vivo, rat full-thickness cutaneous wounds treated with BMSCs combined with NPWT exhibited better viability of the cells and enhanced angiogenesis and maturation of functional blood vessels than did local BMSC injection or NPWT alone. Expression of angiogenesis markers (NG2, VEGF, CD31, and
The healing of large areas of full-thickness skin defects is a challenging clinical problem [
Mesenchymal stem cells have been shown to play an important role in the healing of cutaneous wounds [
Currently, several reports have described the environmental factors, including physical forces and soluble factors, driving MSC differentiation toward endothelial cell line, which is helpful to angiogenesis [
Negative pressure wound therapy (NPWT) is a promising treatment that has become widely adopted and applied for wound repair since its advent over 15 years ago [
Several studies reported the application of negative pressure to influence the biological behavior of cells in vitro. Wilkes et al. designed a bioreactor to explore the effect of subatmospheric pressure upon the fibroblasts and observed changed morphology, thicker appearance, and organized actin cytoskeleton of cells [
We hypothesized that NPWT would improve the viability of the BMSCs and induce BMSCs differentiation into the cutaneous tissue related cell types and enhance their angiogenic capacity, leading to an accelerated angiogenesis for wound healing and regeneration.
All the experimental procedures were according to the guidelines for the Care and Use of Laboratory Animals of the National Institutes of Health and approved by the Institutional Animal Care and Use Committee (IACUC) of Wuhan University.
Briefly, 3-week-old male Sprague-Dawley (SD) rats (Laboratory Animal Center of Wuhan University, China) were sacrificed, and the bone marrow was obtained by flushing the marrow cavity with complete BMSC culture medium containing low-glucose Dulbecco’s modified Eagle’s medium (L-DMEM, Hyclone, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin-streptomycin (P/S, Invitrogen, USA). After centrifugation, the cells were resuspended and cultured at 37°C in 5% CO2. Cells of 3-4 passages were used for the following experiments. BMSCs were characterized by flow cytometry analysis at the third passage. CD90 (Biolegend, USA), CD45 (Biolegend, USA), CD44 (Biolegend, USA), and CD31 (Affymetrix eBioscience, USA) were used to identify the surface marker of BMSCs.
For the NPWT group, cells were cultured in the flask at a pressure of −150 mmHg for 9 days. Briefly, BMSCs were seeded in the T25 (25 cm2) at 37°C in 5% CO2 in incubator, and one needle was penetrated through the plug cap and inserted into the flask, and the end of the needle was connected to a vacuum pump (VSD Inc.) that generated continuously suction at continuous −150 mmHg. The control group was maintained in a similar incubator and same device but without negative pressure.
BMSCs cultured in the flask under NPWT or not were fixed in 4% paraformaldehyde (Aspen, China) for 1.5 h and stained with FITC-conjugated phalloidin (Yeasen, China) for 1 h. Finally, samples were stained with diamidine-phenylindole-dihydrochloride (DAPI, Aspen, China) and analyzed with a confocal fluorescence microscope system (Leica SP2, Leica, Germany).
To evaluate cell proliferation under NPWT, on days 1, 3, 6, and 9 after NPWT treatment, a CCK-8 assay was performed. BMSCs cultured with normal pressure served as control. To assess BMSCs viability and death under NPWT, a live/dead assay was performed. On days 1, 3, 6, and 9, the cells in the culture flask were incubated with 1 mM calcein AM (Wako, Japan) for 1 h and then incubated with 1 ug/mL propidium iodide (PI, Invitrogen, USA) for 5 min at 37°C. Next, the cells were imaged using a fluorescence microscopy (IX51, Olympus, Japan). Live cells stained green, whereas dead cells stained red.
Male SD rats weighing 250–300 g were purchased from the Laboratory Animal Center of Wuhan University (China) in accordance with the Institutional Animal Care and Use Committee (IACUC) of Wuhan University.
Rats were randomly divided into four groups: sham, NPWT group, local BMSC injection, or BMSC + NPWT group (
On days 0, 3, 6, and 9 after operation, the wounds were photographed and wound tissues were harvested. For histological analysis, the harvested specimens were immediately snap-frozen in Optimal Cutting Temperature compound (OCT compound) (Sakura Finetek, Torrance, CA) or fixed in 4% paraformaldehyde overnight and embedded in paraffin for hematoxylin and eosin (H&E) staining and Masson’s Trichrome staining and immunohistochemistry and immunofluorescence analyses.
The wound area was calculated using Image Pro Plus 6.0 (IPP 6.0) software (Media Cybernetics, USA). The calculation formula was performed as follows: (wound area on day 0 − wound area day “
Criteria for histological scores of wounds. Criteria of scoring system for granulation tissue formation and wound maturity.
Score | Granulation tissue formation | Wound maturity |
---|---|---|
(1) | No/minimal granulation tissue | Limited cells present or highly inflammatory |
(2) | Low granulation tissue | Predominantly inflammatory |
(3) | Moderate granulation tissue | Equivalence between inflammatory and proliferative |
(4) | Extensive granulation tissue | Predominantly proliferative |
(5) | Very extensive granulation tissue | Highly proliferative |
BMSCs were cultured under NPWT or normal condition for 9 days. For in vivo RT-PCR, wound tissues harvest at indicated time points was stored at −80°C. Then, Total RNA was extracted via the TaKaRa MiniBEST Universal RNA Extraction Kit (Takara Bio, Japan) following the manufacturer’s instructions. cDNA was synthesized using the PrimeScript™ II First Strand cDNA Synthesis Kit according to the manufacturer’s protocol (Takara Bio, Japan). PCR conditions comprised an initial step of denaturation for 1 min at 95°C, followed by total 40 cycles of 15 s at 95°C, 20 s at 58°C and 20 s at 72°C. After normalization against the housekeeping gene
The primer sequences for each primer used in the real-time RT-PCR. The primer sequences and annealing temperature of CD31,
Genes | Primer sequences | Annealing temperature (°C) |
---|---|---|
Forward: CGTTGACATCCGTAAAGACCTC | 58 | |
CD31 | Forward: GATCTCCATCCTGTCGGGTAAC | 58 |
Forward: CAACCCCTATACAACCATCACAC | 58 | |
VEGF | Forward: ATCTTCAAGCCGTCCTGTGTG | 58 |
NG2 | Forward: TTACCTTGGCCTTGTTGGTC | 58 |
Total protein was isolated from BMSCs cultured under NPWT or normal condition or from wound tissues harvested at the indicated time points with a Total Protein Extraction Kit (Aspen, China). Equal amounts of protein from cells or tissue lysates were loaded onto a 5% SDS polyacrylamide gel (Aspen, China) and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, USA). Membranes were blocked with 5% BSA in TBS and then incubated with primary antibodies against CD31 (1 : 500),
BMSCs cultured under NPWT or normal condition or the wound tissues on day 9 were fixed in 4% paraformaldehyde for 20 min. For wound tissues, the samples were further embedded in paraffin and cross-sectioned at 5
The concentrations of TGF-
To assess blood vessel formation, immunohistochemistry was performed on day 6. The tissue sections described above were incubated with primary antibodies (anti-collagen type IV, 1 : 100, and anti-CD31, 1 : 100, Abcam, United Kingdom) overnight at 4°C and then incubated with HRP-coupled secondary antibodies (Aspen, China). Staining was performed using diaminobenzidine (brown). For each section, tube-like structures were considered to be newly formed blood vessels and were quantified. Furthermore, to quantify the number of mature blood vessels, six sections from different tissue samples were selected from each treatment group for immunofluorescence analysis on day 9. CD31 (for endothelial cells),
All of the values are expressed as mean ± SD. Statistical significance between two groups was measured using the Student’s unpaired
Cultured cells expressed CD44 (98.61%) and CD90 (98.87%) and did not express CD31 (1.66%) and CD45 (6.52%), demonstrating that the cells obtained from SD rats were BMSCs (Figure
Characterization of BMSCs. Flow cytometry results of BMSCs at passage 3.
In comparison with standard culture (Figures
BMSCs morphology, viability, and proliferation under NWPT. (a) Light microscopy revealed morphology of BMSCs cultured in plates at 3 passage. (b) Fluorescent micrograph of BMSCs cultured in plates at 3 passages. (c) A representative image of live/dead assay at 9 days. Green: live cells, red: dead cells. (d) Fluorescent microscope image when BMSCs were cultured under NPWT. (e) The result of live/dead assay of BMSCs cultured under NPWT in vitro for 9 days. (f) An CCK-8 assay was used to assess proliferation of BMSCs with or without NPWT over 9 days. Data is given as the mean ± SD.
We examined different angiogenesis related cell markers including NG2 (for pericytes) and
Effect of NPWT on BMSC differentiation. (a) qRT-PCR analysis of NG2, VEGF, CD31, and
Gross photographs of wound healing progression from each group in the cutaneous wound model were shown in Figure
Evaluation of wound tissues. (a) Representative gross photos of the wounds treated with sham operation, BMSCs, NPWT, and BMSCs + NPWT. (b) Wound closure curves demonstrated significantly accelerated wound healing in BMSC + NPWT group. (c) H&E staining, Masson’s trichrome staining, and picrosirius red staining of wounds at day 9. Data is given as the mean ± SD,
As shown in Figure
Using immunohistochemistry to explore CD31 expression, we observed abundant new blood vessels in BMSC + NPWT treated wounds but few in the sham group wounds on day 9 (
BMSC + NPWT accelerate the formation of vascularized granulation tissue. (a) Immunohistochemical staining for CD31 and collagen IV, representing newly formed blood vessels. (b) Quantification of newly formed blood vessels. (c) Quantification of collagen IV expression. Data is given as the mean ± SD,
Immunofluorescence costaining of CD31 and
BMSC + NPWT accelerate the formation of mature vessel. (a) Immunofluorescence staining for CD31 and a-SMA. Red and green costaining represented mature blood vessels. Nuclei were stained with DAPI (blue). (b) Quantification of mature blood vessels. (c) Granulation tissue score and wound maturity score. (d) Concentration of TGF-
In addition, granulation and wound maturity scores in the BMSC + NPWT group were both significantly higher than those in the sham groups (
In addition, western blot analyses reflected enhanced NG2, CD31, VEGF, and
Assessment of angiogenesis related factors and cytokines. (a) Western blotting of NG2, VEGF, CD31, and
Assessment of angiogenesis related factors and cytokines. (a) Immunofluorescence staining of CD31, VEGF, and
Our study investigated whether the combinatory strategy using BMSC injection coupled with NPWT can exert therapeutic effects in a murine cutaneous defect model and explored the underlying mechanisms involved. Our results demonstrated for the first time that BMSC + NPWT could significantly promote cutaneous wound healing, characterized by robust and enhanced vascularization at wound sites. Specifically, we have demonstrated that full thickness skin wounds treated with BMSCs combined with NPWT lead to acceleration of angiogenesis when compared to rats receiving topical administration of NPWT without stem cells. More importantly, we found that NPWT provided a beneficial microenvironment supporting better BMSC’s viability and promoted their angiogenic capacity for abundant neoangiogenesis and maturation of blood vessels, suggesting that this strategy may serve as an alternative to aid fundamental soft tissue reconstruction for wound healing. Thus, a major challenge in regenerative medicine to create a functional microenvironment which supports and facilitates the angiogenic properties of BMSCs to enhance wound healing has been met, and this would further help to pave the way to clinical application.
During the past few years, negative pressure wound therapy (NPWT) has emerged as a treatment for those complex wounds that need effective therapy to heal. This method is the delivery of intermittent or continuous subatmospheric pressure through a particular pump, connecting to a poriferous and foam-surface dressing covered with an adhesive drape to maintain a vacuum environment [
Previously, we have demonstrated that negative pressure (−125 mmHg) could induce the differentiation of periosteum-derived mesenchymal stem cells (P-MSCs) toward the osteogenic phenotypes after the 7 days cultured with the help of osteogenic inductive medium. For healing cutaneous wounds, some reports have been demonstrated that high levels of negative pressure (approximately −150–200 mmHg) may be efficient to induce macromechanical deformation of wounds and may be more favorable in soft tissue wounds [
Particularly, hypoxia condition is beneficial for maintaining hMSCs in proliferating condition, especially in the late stage of hypoxia microenvironment such as 7 days. In addition, hMSCs would maintain their growth-rates even after reaching confluence and also exhibit differences in the cell and nuclear morphologies as well as accelerated ECM organization, leading to the better tissue regeneration [
Wound healing is a dynamic development that comprises the network among the extracellular matrix (ECM), growth factors, and various types of resident cells. It begins with the proliferation of fibroblasts generation of collagen fibers and angiogenesis, leading to granulation tissue, wound contraction, and epithelialization. Notably, vasculogenesis and angiogenesis are indispensable for wound healing. Angiogenesis consists of the sprouting and remodeling of the primitive blood vessels, followed by the stabilization of mural cells (e.g., pericytes for small vessels and smooth muscle cells for large vessels) [
Currently, studies of cell-based treatment of complex wounds have largely focused on the use of MSCs transplanted topically, via injection around the edges of the wound directly [
These findings demonstrate that the capacity of NPWT to enhance BMSC angiogenic property for cutaneous wound healing potentially by preserving the viability of the cells, stimulating, and inducing them to differentiate into the desired cells that are beneficial for angiogensis within wounds. This combinatory strategy is superior to either of cells transplantation and NPWT therapy alone, leading to the accelerated wound healing. Further optimization of the applicable parameter of NPWT and BMSCs may provide more benefits to clinical application.
The authors have declared that there is no conflict of interests.
Kangquan Shou and Yahui Niu contributed equally to this work.
This work was supported by Grants from the National Natural Science Foundation of China (Grant no. 81572163).