The key mechanisms responsible for achievement of full reproductive and developmental capability in mammals are the differentiation and transformation of granulosa cells (GCs) during folliculogenesis, oogenesis, and oocyte maturation. Although the role of 17 beta-estradiol (E2) in ovarian activity is widely known, its effect on proliferative capacity, gap junction connection (GJC) formation, and GCs-luteal cells transformation requires further research. Therefore, the goal of this study was to assess the real-time proliferative activity of porcine GCs in vitro in relation to connexin (Cx), luteinizing hormone receptor (LHR), follicle stimulating hormone receptor (FSHR), and aromatase (CYP19A1) expression during short-term (168 h) primary culture. The cultured GCs were exposed to acute (at 96 h of culture) and/or prolonged (between 0 and 168 h of culture) administration of 1.8 and 3.6
Proper mammalian oocyte development depends on bidirectional communication via gap junction connections (GJC) occurring between the female gamete and surrounding somatic cumulus cells (CCs) [
Until now, there are few reports that indicate the ability of granulosa cells (GCs) to proliferate in vitro. Recently, we have shown that cumulus cells proliferate in vitro in cumulus-enclosed and cumulus-separated culture models [
It is well known that the mammalian ovary plays two important functions: the production of female gametes and synthesis of ovarian steroid hormones such as estrogen and progesterone. Both of these hormones are involved in hormonal feedback pathways that regulate follicular cell growth and differentiation. Moreover, it is a well-recognized theory that the ability of the ovary to synthetize 17 beta-estradiol (E2) is the main indicator of proper ovarian follicle function and activity. The androgens produced in theca cell layers via conversion are used in the synthesis of estrogen in granulosa cells. Moreover, GCs produce estrogen, and exposure to exogenous estrogen, due to administration of E2, might trigger negative feedback of estrogen in granulosa cells [
Since it was found that E2 is actively synthetized in GCs, it is hypothesized that E2 may play an important role in GC proliferation and GC-CC differentiation [
A total of 40 pubertal crossbred Landrace gilts, bred on a local, commercial farm, were used for this study. They had a mean age of 155 days (range: 140–170 days) and a mean weight of 100 kg (95–120 kg). All animals were housed under identical conditions and fed the same forage (depending on age and reproductive status). The experiments were approved by the Local Ethics Committee.
Ovaries and reproductive tracts were obtained at the time of slaughter and transported to the laboratory within 40 min at 38°C in 0.9% NaCl. To provide optimum conditions, the ovaries of each animal were placed in 5% fetal bovine serum (FBS; Sigma-Aldrich Co., St. Louis, MO, USA) in PBS [
The recovered GCs were transferred to an E-Plate 16 of a real-time cell analyzer (RTCA, Roche-Applied Science, GmbH, Penzberg, Germany) consisting of an RTCA Analyzer, an RTCA SP Station, and RTCA software. The GCs were then cultured in 200
Total RNA was isolated from GCs before (at 0 h) and after (24, 48, 72, 96, 120, 144, and 168 h) IVC using an RNeasy mini column from Qiagen GmbH (Hilden, Germany). The RNA samples were resuspended in 20
Oligonucleotide sequences used for RT-qPCR analysis.
Gene | Gene accession number | Primer sequence (5′-3′) | Product size (bp) |
---|---|---|---|
CYP19 | NM_214429.1 | AAAGACGCAGGATTTTCACA |
97 |
FSHR | NM_214386.2 | GAATTGAAAAGGCCAACAAC |
214 |
LHR | NM_214449.1 | AAGCACAGCAAGGAGACCAA |
231 |
Cx36 | XM_001924757.4 | AGCAGCACTCCACTATGATCGG |
123 |
Cx37 | NM_001244224.1 | GTGTGTCCGCACCGCCACCGATGA |
155 |
Cx40 | XM_003130802.2 | ATCGCTTTCACCTGCAAGTCC |
220 |
Cx43 | NM_001244212.1 | CAGCACTTTTCTTTCATTAGGGGC |
194 |
ACTB | XM_003124280.3 | CCCTTGCCGCTCCGCCTTC |
69 |
PBGD | NM_001097412.1 | GAGAGTGCCCCTATGATGCT |
214 |
To quantify specific genes expressed in the GCs, the expression levels of specific oocyte mRNAs in each sample were calculated relative to beta-actin (ACTB) and porphobilinogen deaminase (PBGD). To ensure the integrity of these results, the additional housekeeping gene 18S rRNA was used as an internal standard to demonstrate that ACTB and PBGD mRNAs were not differentially regulated in the groups of GCs. The expression of 18S rRNA has been identified as an appropriate housekeeping gene for use in quantitative PCR studies. Expression of ACTB, PBGD, and 18S rRNA mRNA was measured in cDNA samples from isolated GCs.
A one-way ANOVA, followed by Tukey’s post hoc test, was used to compare the results of the real-time quantification of the proliferation index. The experiments were carried out in at least two replicates. The results quantifying the cell proliferation index were obtained using an RTCA system. The differences were considered to be significant at
Using an RT-qPCR assay, we analyzed the relative abundance of Cx36, Cx37, Cx40, Cx43, LHR, FSHR, and CYP19 mRNA after each period of GC real-time proliferation in vitro. Two housekeeping genes, ACTB and PBGD (data not shown), were used to normalize sample-to-sample RT-qPCR assays. The aim was to check whether mRNA expression profile changed among the groups. Additionally, two housekeeping genes were applied to check the total RNA isolation efficiency.
We found increased expression of Cx36 mRNA in control (untreated cells) at 0 h of IVC (
Relative abundance of Cx36 transcript in porcine follicular granulosa cells analyzed during 168 h of IVC. Porcine follicular granulosa cells were isolated from pubertal gilts and immediately used to isolate RNA, which was reverse-transcribed into cDNA. The relative abundance of Cx36 mRNA was evaluated by RT-qPCR analysis before and after each 24 h of IVC. The results are presented as the mean ± SEM with the level of significance shown as
Relative abundance of Cx37 transcript in porcine follicular granulosa cells analyzed during 168 h of IVC. Porcine follicular granulosa cells were isolated from pubertal gilts and immediately used to isolate RNA, which was reverse-transcribed into cDNA. The relative abundance of Cx37 mRNA was evaluated by RT-qPCR analysis before and after each 24 h of IVC. The results are presented as the mean ± SEM with the level of significance shown as
Relative abundance of Cx40 transcript in porcine follicular granulosa cells analyzed during 168 h of IVC. Porcine follicular granulosa cells were isolated from pubertal gilts and immediately used to isolate RNA, which was reverse-transcribed into cDNA. The relative abundance of Cx40 mRNA was evaluated by RT-qPCR analysis before and after each 24 h of IVC. The results are presented as the mean ± SEM with the level of significance shown as
Relative abundance of Cx43 transcript in porcine follicular granulosa cells analyzed during 168 h of IVC. Porcine follicular granulosa cells were isolated from pubertal gilts and immediately used to isolate RNA, which was reverse-transcribed into cDNA. The relative abundance of Cx43 mRNA was evaluated by RT-qPCR analysis before and after each 24 h of IVC. The results are presented as the mean ± SEM with the level of significance shown as
Relative abundance of LHR transcript in porcine follicular granulosa cells analyzed during 168 h of IVC. Porcine follicular granulosa cells were isolated from pubertal gilts and immediately used to isolate RNA, which was reverse-transcribed into cDNA. The relative abundance of LHR mRNA was evaluated by RT-qPCR analysis before and after each 24 h of IVC. The results are presented as the mean ± SEM with the level of significance shown as
Relative abundance of FSHR transcript in porcine follicular granulosa cells analyzed during 168 h of IVC. Porcine follicular granulosa cells were isolated from pubertal gilts and immediately used to isolate RNA, which was reverse-transcribed into cDNA. The relative abundance of FSHR mRNA was evaluated by RT-qPCR analysis before and after each 24 h of IVC. The results are presented as the mean ± SEM with the level of significance shown as
Relative abundance of CYP19A1 transcript in porcine follicular granulosa cells analyzed during 168 h of IVC. Porcine follicular granulosa cells were isolated from pubertal gilts and immediately used to isolate RNA, which was reverse-transcribed into cDNA. The relative abundance of CYP19A1 mRNA was evaluated by RT-qPCR analysis before and after each 24 h of IVC. The results are presented as the mean ± SEM with the level of significance shown as
Using the RTCA system, the proliferation index (PI) and effects of acute and prolonged E2 treatment were assessed. In the first experiment, the porcine GCs were cultured with 1.8 and 3.6
Cell proliferation index (CI) of porcine follicular granulosa cells cultivated for 168 h after acute and prolonged E2 treatment. Porcine follicular granulosa cells were recovered from pubertal gilts and treated with collagenase for 10 min at 38.5°C. The cells were immediately transferred into an E-Plate 48 of a real-time cell analyzer (RTCA, Roche-Applied Science, GmbH, Penzberg, Germany). The experiment consisted of eight replicates involving the cultivation of the same population of collected cells. In the first experiment, the porcine GCs were cultured with 1.8 and 3.6
In the second experiment, the effect of acute E2 treatment on GCs during the logarithmic increase of proliferation was assessed. Similarly, the PI was evaluated at three different time periods. When analyzing complete culture periods 0–168 h, we did not observe differences in PI between the control and treatment groups (Figure
Cell proliferation index (CI) of porcine follicular granulosa cells cultivated for 168 h with acute E2 treatment during the logarithmic increase of proliferation. Porcine follicular granulosa cells were recovered from pubertal gilts and treated with collagenase for 10 min at 38.5°C. The cells were immediately transferred into an E-Plate 48 of real-time cell analyzer (RTCA, Roche-Applied Science, GmbH, Penzberg, Germany). The experiment consisted of eight replicates involving the cultivation of the same population of collected cells. Similarly, the PI was evaluated at three different time periods, that is, 0–168 h (Figure
Mammalian cumulus-oocyte complex (COC) maturation, both in vivo and in vitro, belongs to compound processes orchestrated by substantial morphological and molecular changes occurring within denuded oocytes and surrounding somatic cumulus-granulosa cells [
Minimal data exists indicating CC expansion is associated with significant changes in the biochemical prolife of target gene expression. In the current study, we assessed the expression profile of Cxs, which function as CC-oocyte communication markers, and the activity of GJC during short-term, real-time cell proliferation. We found that the profile of Cxs expression during 168 h of IVC was substantially changed. Furthermore, acute and/or prolonged effect of E2 supplementation on cell proliferation was also observed. It is widely known that E2 is crucial for proper functions of reproductive processes in mammals, especially in folliculogenesis and oogenesis regulation. Moreover, estrogen, produced by mature ovarian follicle, is a noteworthy factor in the proliferative phase of the endometrium. However, it is not fully recognized if E2 influences GJC activity via upregulation of Cx expression. The results from the current study clearly demonstrated that E2 may modulate Cx expression after acute and/or prolonged treatment, and it may be the potential factor associated with paracrine activity of both oocytes and CCs during the induction of gamete-somatic cell “crosstalk.”
The role of estrogen and progesterone hormones on Cx expression in various types of ovarian tissue was recently investigated in several mammalian species [
Recently, Saadeldin et al. investigated the interaction between porcine denuded oocytes and GCs in juxtacrine and paracrine bidirectional interaction models in relation to Cx43 expression [
Similarly, our results indicated an association between the PI during short-term, porcine GCs in vitro culture and the expression profile of selected Cxs in relation to the stimulatory effect of E2 administration. In our recent study, we investigated the expression of selected connexins such as Cx36, Cx37, Cx40, and Cx43 mRNA by RT-qPCR as well as distribution of Cx30, Cx31, Cx37, Cx43, and Cx45 proteins in porcine GCs during short-term (168 h), real-time cell proliferation in vitro [
Testosterone’s effect on 17 beta-estradiol secretion as related to aromatase activity was previously researched using a GC rat model by Lee et al. [
The function of GCs isolated from oocytes of young, middle-aged, and older infertile patients, as related to steroidogenesis, apoptosis, and gonadotropin activity during ovarian ovulation, was recently investigated by Wu et al. Similar to our study, GCs were collected form ovarian follicular fluid and the expression of FSHR, CYP19A1, HSD17B, LHR, CYP11A1, and PGR (progesterone receptor) was assessed. They found that FSHR, CYP19A1, and HSD17B expression was decreased in GCs isolated from aged patients, whereas LHR, CYP11A1, and PGR were stimulated in this group. Moreover, the in vitro proliferation of GCs was lower, and the rate of apoptosis was increased in aged patients. The premature luteinization was accompanied by an age-related decline of GC function in vitro, whereas addition of FSH to the culture prevented GC luteinization [
The results of the current study indicated increased expression of both gonadotropin receptors (LHR and FSHR) at 0–24 h in untreated control, whereas upregulation of these genes at 48–72 h after E2 administration was observed. It is suggested that E2 treatment reflects a stimulatory effect on GCs in vitro proliferation, the ability to reach log phase at 72 h, and expression of LHR. Moreover, LHR expression may be recognized as a GC-luteal cell transformation marker since the highest expression level was observed between 48 and 72 h. Additionally, the upregulation of FSHR at 72 h of IVC is also accompanied by a substantial increase of porcine GC proliferation in vitro. It is widely known in several mammalian species that primary culture of GCs and/or research based on GC-luteal cell transformation is a reliable and convenient model for ovarian folliculogenesis and may be recognized as a specific “fingerprint” of this process.
Baufeld and Vanselow investigated the morphological and physiological properties of bovine GCs in vitro in relation to luteinization marker expression and methylation status [
This study has been approved with resolution 32/2012 by Local Ethical Committee in Poznań.
The authors declare that they have no competing interests.
This study was made possible by Grant no. 2014/13/D/NZ9/04798 “SONATA” from Polish National Centre of Science and 502-14-02227367-10694 from Poznan University of Medical Sciences.