ARG1, which encodes Arginase1, is expressed in the liver cytoplasm and plays a major role in the hepatic urea cycle. The past research works shed light on the fact that ARG1 participates in anti-inflammation, tumor immunity, and immunosuppression-related diseases. Nevertheless, the concrete role and clinical significance of ARG1 in the progression of hepatocellular carcinoma (HCC) remain unclear. Herein, we aimed at examining the expression and clinicopathological significance of ARG1 in HCC, together with determining the effect of ARG1 on the progression and metastasis of HCC. In the current study, evaluation of the expression of ARG1 and clinicopathological significance of ARG1 was carried out in the human HCC tissues microarray, and the ARG1 overexpression vector and shRNA-ARG1 plasmids were constructed for the assessment of the concrete effect of ARG1 on cellular behaviors of Huh7 cells. As our data revealed, ARG1 was significantly downregulated in HCC, and the higher expression of ARG1 was positively correlated with more aggressive tumor growth, size, ALT, and GGT level. Significantly, we found that the high expression of ARG1 was correlated with poor DFS of HCC patients. Besides, in vitro study revealed that overexpression of ARG1 could enhance arginase activity, cell viability, migration, and invasion of Huh7 cells, and loss-of-function of ARG1 by shRNA interference could inhibit these cellular behaviors. Additionally, overexpression of ARG1 led to a significant increase in the expression of Vimentin, N-cadherin, and
Hepatocellular carcinoma (HCC) is termed as a common and aggressive malignancy, which ranks as the second leading cause of the cancer-related deaths, annually leading to more than 110,000 mortalities worldwide [
Arginase is considered as a pivotal metabolic enzyme, which catalyzes the hydrolysis of arginine to ornithine and urea. Since the L-ornithine produced by arginase will further metabolize to polyamines, which is involved in the multiple fundamental cellular functions, arginase has been revealed to impact an array of pivotal downstream metabolic pathways [
In the present study, we aimed to examine the expression and clinicopathological significance of ARG1 in HCC and, furthermore, figure out the role of ARG1 in the progression and metastasis of HCC. Our data reported that ARG1 was downregulated in HCC tissues and was correlated with prognosis of patients. We also identified that ARG1 functioned as an oncogene in HCC, based on the fact that knockdown of ARG1 by shARG1 interference could decrease cell proliferation activity and motility of HCC cell, while ARG1 overexpression could promote tumor-related phenotypes in HCC cells. As the results indicate, ARG1 might be a potential prognosis predictor for HCC patients, together with being a novel target for HCC treatment.
The human HCC tissues microarray was obtained from Shanghai Outdo Biotech Company (LivH180Su06, Shanghai, China), which included HCC tissues and corresponding paracancerous tissues from 90 cases of HCC patients. The clinicopathological information of the HCC patients, including age, gender, tumor size, tumor envelope, relapse, cirrhotic nodule, pathological grading, total bilirubin (TB), alanine aminotransferase (ALT), glutamyltransferase (GGT), and alpha fetoprotein (AFP) levels, was summarized in Table
The HCC cell line Huh7 was obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China), followed by culturing in DMEM (Dulbecco’s Modified Eagle Medium, Thermo Fisher, USA) medium containing 10% FBS (Gibco, USA) at 37°C under 5% CO2. Huh7 cells were infected with lentiviral particles loading the overexpression ARG1 plasmid (OE-ARG1), overexpression control plasmid (OE-NC), shRNA-ARG1 plasmid (sh-ARG1), and shRNA control plasmid (sh-NC), correspondingly. And Huh7 cells without any treatment were used as the control group (CON).
The ARG1 overexpression plasmid, shRNA-ARG1 plasmids, and their negative control plasmids were packaged into lentiviral particles. The full CDS sequence of ARG1 was amplified and cloned into pLenO-GTP (Biotheon Technologyco., LTD, Fuzhou, China). Three shRNA sequences targeting ARG1 were synthesized, and the sequences were as follows: shRNA-ARG1-1#: GCAGCAAAGAGAAGTGTCAGA; shRNA-ARG1-2#: GGATTATTGGAGCTCCTTTCT; shRNA-ARG1-3#: GCCCTACAGTATTGAGAAAGG. The pLenO-gph (Biotheon Technologyco) vector was performed to construct shRNA plasmid. Tronolab system (Tronolab, Switzerland) was adopted for lentivirus packaging to obtain stably expressing ARG1, shRNA-ARG1, or negative control (NC), which were used to infect Huh7 cells.
EliVisionTMplus kit (Maixin, China) was used for immunohistochemistry assay in accordance with the manufacturer’s instructions [
Total RNA was extracted using Trizol (PuFei, China) and then reverse transcribed to cDNA using SuperRT cDNA Synthesis kit (CWBIO, Beijing, China). The expression of gene mRNA was examined using SYBR Master Mixture (Takara, Ohtsu, Japan). Primers were as follows: ARG1: Upstream: 5′- TTGGCTTGAGAGACGTGGAC -3′, Downstream: 5′- GTGCCAGTAGCTGGTGTGAA -3′; Vimentin: Upstream: 5′- GACGCCATCAACACCGAGTT-3′, Downstream: 5′- CTTTGTCGTTGGTTAGCTGGT-3′; N-cadherin: Upstream: 5′- AGCCAACCTTAACTGAGGAGT-3′, Downstream: 5′- GGCAAGTTGATTGGAGGGATG-3′;
Protein was extracted by using RIPA Lysis Buffer (CWBIO), followed by being quantified using a BCA Protein Assay Kit (Beyotime, Shanghai, China). Protein (20
Almost 1×104 transfected cells were harvested and lysed in Tris-HCl containing 1
CCK8 assay was carried out for the examination of cell viability. About 2×104 infected Huh7 cells were seeded into each well of 96-well plates and cultured for 48 h. The cells were further cultured following the addition of CCK8 reagent (10
Cell wound scratch assay and Transwell assay were performed to examine cell migration. With regard to cell wound scratch assay, about 2×104 infected Huh7 cells per well were seeded into both sides of the scratch plate (NEST, Wuxi, China) for 24 h incubation, followed by taking out the separator and taking pictures under the microscope (Olympus, Japan). Subsequent to a period of 24 h, the cell migration was observed under the microscope and pictures were taken. With regard to Transwell migration assay, about 4×104 infected Huh7 cells were cultured with medium in the upper chamber (Millipore, MA, USA) for 24 h. Subsequent to that, cells were fixed with methanol for 30 min. Thereafter, the filters were stained with 0.1% crystal violet for 25 min, followed by observing under the microscope and taking pictures. With regard to Transwell invasion assay: the Transwell chambers were coated with Matrigel (BD Bioscience, New Jersey, USA). About 4×104 infected Huh7 cells were added to the top chamber, and medium with 20% FBS was added to the lower chamber. Subsequent to a period of 24 h, invaded cells were stained using 0.1% crystal violet for 25 min, and photographed under the microscope.
After being infected for 20 h, cells were centrifuged at 2,000 × g for 10 min, and cell culture supernatants were collected to assay using the Human E-cadherin SimpleStep ELISA kit (Abcam) and Human Arginase 2 (ARG2) ELISA Kit (KALANG, Shanghai, China) according to the instructions.
In the current study, the data were presented as the mean ± SE, and the statistical analysis was carried out with the use of the SPSS 20.0. The Pearson Chi-Square analysis was employed to analyze the correlation between expression of ARG1 and clinicopathological characteristics of HCC patients. Student’s
To determine the expression of ARG1 in HCC, the HCC tissues microarray was carried out. As evident from Figure
ARG1 expression in HCC compared with paracarcinoma tissue.
Group | n | ARG1 expression | P | |
---|---|---|---|---|
Low (n%) | High (n%) | |||
HCC | 90 | 73 (81.1) | 17 (18.9) | 0.001 |
para-carcinoma | 90 | 12 (13.3) | 78 (86.7) |
ARG1 expression associated with the clinicopathological parameters in HCC.
clinicopathological parameters | n | ARG1 Low (n%) | ARG1 High (n%) | P |
---|---|---|---|---|
Gender | ||||
Male | 74 | 59 (79.7) | 15 (20.3) | 0.713 |
Female | 16 | 14 (87.5) | 2 (12.5%) | |
Age (years) | ||||
<60 | 69 | 54 (78.3) | 15 (21.7) | 0.350 |
≥60 | 21 | 19 (90.5) | 2 (9.5) | |
Tumor diameter (cm) | ||||
<5 | 44 | 40 (90.9) | 4 (9.1) | 0.020 |
≥5 | 46 | 33 (71.7) | 13 (28.3) | |
Tumor envelope | ||||
Yes | 47 | 40 (85.1) | 7 (14.9) | 0.311 |
No | 43 | 33 (76.7) | 10 (23.3) | |
Relapse | ||||
Yes | 53 | 41 (77.4) | 12 (22.6) | 0.276 |
No | 37 | 32 (86.5) | 5 (13.5) | |
Cirrhotic nodule | ||||
Yes | 78 | 64 (82.1) | 14 (17.9) | 0.853 |
No | 12 | 9 (75.0) | 3 (25.0) | |
Pathological grading | ||||
I-II | 58 | 51(87.9) | 7 (12.1) | 0.026 |
III-IV | 32 | 22(68.8) | 10 (31.2) | |
DFS | ||||
<12 | 21 | 13 (61.9) | 8 (38.1) | 0.027 |
≥12 | 68 | 59 (86.8) | 9 (13.2) | |
TB | ||||
<20 | 74 | 60 (81.1) | 14 (18.9) | 1.000 |
≥20 | 16 | 13 (81.3) | 3 (18.7) | |
ALT | ||||
| 41 | 38 (92.7) | 3 (7.3) | 0.010 |
≥40U/L | 49 | 35 (71.4) | 14 (28.6) | |
GGT | ||||
<40 U/L | 24 | 24 (100.0) | 0 (0) | 0.014 |
≥40U/L | 66 | 49 (74.2) | 17 (35.8) | |
AFP | ||||
<400ng/ml | 54 | 48 (88.9) | 6 (11.1) | 0.106 |
≥400ng/ml | 33 | 25 (75.8) | 8 (24.2) |
ARG1 is downregulated in HCC. Immunohistochemical staining of ARG1 in HCC tissues ((a)×100) and paracarcinoma ((b)×100). These 4 samples were from 90 cases in the human HCC tissues microarray.
ARG1 was observed to be dysregulated in HCC. Besides that, the effects of ARG1 on biological behaviors of HCC cells were further examined as well. Accordingly, the HCC cell Huh7 was transfected with pLenO-ARG1 or shARG1 to obtain stable ARG1 overexpressed cells (OE-ARG1) and ARG1 silenced cells (shARG1), respectively; pLenO (OE-NC) and shRNA control (sh-NC) were used as the negative control, correspondingly. As shown in Figure
ARG1 promotes cell proliferation of Huh7 cells. ((a) and (b)) The expression of ARG1 was significantly upregulated in overexpression cell group (OE-ARG1) and inhibited in shRNA-ARG1-2# interference cell group (sh-2#) both at mRNA (a) and protein (b) level. Then, shRNA-ARG1-2# was used in the further experiment.
CCK8 assay was employed for the detection of the cell proliferation activity and viability of Huh7 cells, highlighting that the ARG1 overexpression could significantly improve the cell viability of Huh7 cells (P<0.05, Figure
To investigate the effect of ARG1 on tumor metastases, cell migration and invasion were examined using cell wound scratch assay and Transwell assays, correspondingly. As shown in Figures
ARG1 promotes cell migration of Huh7 cell. ((a) and (b)) Cell wound scratch assay showed that ARG1 knockdown significantly suppressed cell migration rate of Huh7 cells, while overexpression of ARG1 had no significant effect on cell migration. ((c) and (d)) Transwell assay showed that overexpression of ARG1 promoted cell migration activity of Huh7 cells, and ARG1 knockdown inhibited cell migration activity. N=3,
ARG1 promotes cell invasion of Huh7 cell. ((a) and (b)) Transwell assay showed that overexpression of ARG1 promoted cell invasion of Huh7 cells, and ARG1 knockdown inhibited cell invasion. N=3,
Our data validated that ARG1 could promote the cell motility of HCC cells in vitro; further study was performed to explore the relevant mechanism. It is widely held that EMT constitutes a key process in cancer metastasis and progression. Therefore, the EMT-associated proteins were examined to evaluate the effect of ARG1 on EMT in HCC. As evident from Figures
ARG1 promotes the EMT process of Huh7 cells. ((a)-(c)) ARG1 impaired the expression of EMT-associated proteins at both protein (a, b) and mRNA (c) level, and overexpression of ARG1 significantly upregulated the expression of Vimentin, N-cadherin, and
It is widely held that the hallmarks of cancer include six biological capabilities as the results of genome instability and inflammation. Inflammation, which is a powerful component of the immune system, is one of the features of cancer and is involved in the occurrence and development of cancer [
Arginase is a pivotal metalloenzyme involved in hepatic urea cycle that metabolizes L-arginine to L-ornithine. Since L-ornithine and its metabolite—polyamine—are pivotal components involved in multiple fundamental cellular functions, including cell proliferation and cell membrane transport, arginase plays a key role in the cellular functions as well as various metabolic pathways [
In the current report, the immunohistochemistry assay was performed to assess the expression of ARG1 in HCC tissues and paracancerous tissues. We observed that ARG1 was substantially downregulated in HCC tissues in comparison with the corresponding paracarcinoma tissues. Besides, we also observed that the expression of ARG1 was associated with several clinicopathological features of HCC patients, that the higher expression of ARG1 was positively correlated with more aggressive tumor growth, size, ALT, and GGT level (Table
EMT, which is an essential process for the cell to gain the mesenchymal properties and motility, plays a pivotal role in tumor metastasis and progression [
In summary, for the first time, we shed light on the fact that ARG1 is downregulated in HCC tumor and correlated with prognosis of HCC patients. We also demonstrate that ARG1 functions as an oncogene in the progression of HCC through promoting the EMT process. Our findings also provide a novel potential target for the therapy of HCC.
The data used to support the findings of this study are included within the article.
The authors declare that there are no conflicts of interest regarding the publication of this article.
This study was supported by the Natural Science Foundation of Fujian Province (No. 2016J0105).