Dangguibuxue decoction (DBD), a kind of Chinese herbal medicine, has been widely used to treat blood deficiency disease in China. In this experiment, we studied the effects of the Dangguibuxue decoction (DBD) on the myocardial injury induced by cyclophosphamide in mice. Alanine aminotransferase (ALT), aspartate aminotransferase (AST), creatine kinase (CK), and lactic dehydrogenase (LDH) in serum were detected by commercial kits. Total white blood cell (WBCs), platelets, and cytokines pathological changes of heart tissue were also examined. In addition, the protein levels of the NF-кB pathway were detected to reveal its mechanism. The results showed that DBD significantly decreased the levels of ALT, AST, CK, and LDH and increased WBCs in CTX-induced mice. In addition, DBD significantly alleviated pathological changes of heart tissue. DBD significantly reduced the protein expressions of NF-кB signaling pathway. In summary, DBD can be considered an effective drug to alleviate CTX-induced heart damage in mice.
Cardiovascular disease, a severe health problem, is recognized as one of the most burdensome diseases of society. Ischemia of the myocardium facilitates the development of arrhythmias which might further result in cardiac necrosis [
NF-кB is a key transcriptional factor involved in inflammatory progression of various diseases [
Traditional Chinese medicine has been acknowledged as a major source of medicine, which was used for centuries around the world [
CTX was purchased from (Sigma-Aldrich, St. Louis, MO). ALT, AST, CK, and LDH assay kits were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). All antibodies were supplied from Cell Signaling Technology Inc. (Beverly, MA, USA).
DBD consists of Radix Astragali and Angelica, with a ratio of 5:1. Herbal medicine was authenticated by pharmacists which was provided by Shanghai Huayu Chinese Medicine Co., Ltd., and was produced in Gansu Province. DBD is prepared by boiling water and alcohol extraction. The extract is then sprayed and dried to give residue. The dried residue dissolves in water and gives an oral solution of DBD at a specified concentration and remains at 4°C.
HPLC was performed using Agilent 1200 HPLC with G 1321 A FD and Eclipse AAA columns (4.6× 150 mm, 5 m) and column temperature of 40°C. Mobile phase A (formic acid: water = 1: 1000) and mobile phase B (acetonitrile). Gradient elution procedure is 0-70 minutes, B (0%-63%), 0-20 minutes, B (63%), 20-40 minutes, B (100%), 50 minutes, B (100%-0%), and 50-70 minutes, B (0%). The flow rate was 0.4 ml min−1.
The male ICR mice (20±2 g), acquired from Nantong University (Nantong, China), were maintained prior to experiments in an animal room under standard conditions (23±2°C temperature, 60±10% humidity, 12 h light/dark cycle).
40 male ICR mice were divided into 4 groups; mice in group 1 were given 200 mL of phosphate buffer saline (PBS, orally), mice in group 2 were given a single dose of CTX (200 mg/kg, intraperitoneally), mice in group 3 were given a single dose of CTX (200 mg/kg, intraperitoneally) and then were given DBD (6 g/kg, orally) for 7 consecutive days, and mice in group 4 were given a single dose of CTX (200 mg/kg, intraperitoneally) in the abdominal cavity and then were given DBD (12 g/kg, orally) for 7 consecutive days. Thereafter, after 4 days without administration, at day 12, the blood comes from the orbital plexus of the eye to obtain a serum for subsequent hematology or biochemical analysis. After collection of blood samples, all mice were sacrificed and their spleens were removed and weighed.
The total number of WBCs and platelets was detected in fresh blood samples from all mice using Automatic Biochemical Analyzer. WBCs counts were performed on 0, 2, 4, 8, and 12 day using Automatic Biochemical Analyzer.
For IL-6, TNF-
The levels of AST, ALT CK, and LDH in serum were assayed in consistence with the instruments of commercial test kits (Jiancheng Bioengineering Inc., China).
Mice were intraperitoneally injected with 20% urethane, were anesthetized according to their body weight (0.5 ml/100 g), cut the heart, cut off the excess tissue around the heart, washed the blood stains in normal saline, drained the excess water from the heart with filter paper, were fixed in 4% paraformaldehyde for 24 h, then were dipped in wax, were embedded, and prepared 4
RIPA lysate was used to extract the total protein in the heart tissue of each group of mice, centrifuged at 12,000 rpm for 15 min, and the supernatant was collected. The BCA kit was used to quantify each group of proteins. Each protein sample was subjected to SDS-polyacrylamide gel electrophoresis and then transferred to PVDF membrane. The PVDF membrane was then sealed in 5% skim milk for 2 h. After 2 hours of blocking, the PVDF membrane was placed in the corresponding primary antibody and incubated at 4°C overnight. The next day TBST was washed 4 times for 8 min each time. The PVDF membrane was then placed in a secondary antibody solution and incubated for 2 h at room temperature in a shaker. The PVDF membrane was removed and washed 4 times with TBST for 8 min each time. The gray value of each strip was analyzed by exposing and scanning the strip using a gel imaging system and using densitometry of Bandscan 5.0 software that was used for quantifying the density of each protein band.
Immunohistochemical method was used to detect the expression of p-NF-
According to the manufacturer’s instructions, the total RNA of the heart was extracted from the heart tissue using the TRIZOL reagent (Invitrogen, Life Technologies, CA, USA). The purity of RNA was measured with 2000 thermal science nanodrops (Massachusetts, USA). Next, RNA was transcribed into cDNA using a reverse transcriptase kit (Takara Biotech, Kyoto, Japan). Quantitative real-time PCR (qRT-PCR) analysis was performed using a ChamQ SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd., Nanjing, China) with the CFX Manager software (Bio-Rad Laboratories Inc.). GAPDH was analyzed in each sample for standardized expression. The primers used in this study are listed in Table
Primers used in this study.
Genes | GenBank | Primer sequence (5′-3′) | Primer sequence (3′-5′) |
---|---|---|---|
GAPDH | NM_018007 | CTGAGGACCAGGTTGTCTCC | GAGGGCCTCTCTCTTGCTCT |
AST | NM_018172 | TCAATATGGGGACAATACAC | TACTTTCTTCATTTCCACCTT |
ALT | NM_018109 | TGTATGAAAGTGCTCAAGAT | GCCCTCTTGTGAGTATAAGT |
CK | NM_018081 | CGAACTACTTTATGCCC | GAAGACAAACGAGGTCTCTA |
LDH | NM_001890 | TATCGAGTCGAGTACGCCAA | GTGTGGGACTTTTCCATCAAA |
All data were presented as mean values ± SDs. Differences between groups of different treatments were evaluated by ANOVA with Tukey multiple comparison test, with P-values of 0.05 or less considered as statistical significance.
As shown in Figure
HPLC analysis of DBD. The main ingredients of DBD were detected by HPLC which was performed using Agilent 1200 HPLC with G1321A FD. (a) HPLC of DBD sample. (b) HPLC of standards. (1) Astragaloside IV. (2) Ferulic acid.
As it was shown in the data, there are significant changes in the spleen weights between the group 1 mice injected with PBS and other groups mice that were injected with CTX. Compared with the control group (group 1), the spleen weights of the mice that were injected alone with CTX shown decreased, while the mice injected with CTX along with two doses of DBD presented a marked elevation (p<0.05). Particularly, high doses DBD (12 g/kg) treatment facilitated the spleen weight growth, suggesting DBD seemed to exhibit its effect in conjunction with spleen function (Figure
Figure
Effects of DND on hematological parameters. The white blood cell (WBCs) counts and the total platelets were detected from fresh blood samples acquired from the eyes of all groups with the electronic blood counter. All values given are the mean ± SD. #P<0.05 and ##P<0.01 versus control group.
In contrast to group 1, the mice injected alone with CTX in group 2 showed an observable decrease in the total number of the platelets. However, after DBD (6,12 g/kg) treatments animals in group 3 or 4 all increase directly the total number of the platelets closer to the level of normal group than that of model group (group 2). Interestingly, data suggested higher dose of DBD (12 g/kg) might obtain more apparent prevention in total number of blood platelets than a lower dose of DBD (6 g/kg) Figure
The serum levels of AST, ALT, CK, and LDH are features of myocardial damage. As depicted in Figure
Effects of DND on serum biochemical parameters. Activities of serum aminotransferase including AST and ALT were assayed in consistence with the instruments of commercial test kits. LDH and CK levels in the serum were also measured according to the methods described by the protocols of commercially available standard kits. All values given are the mean ± SD. #P<0.05 and ##P<0.01 versus control group.
Histological examination of the cardiac tissues from the control group (group 1) and model group (group 2) revealed a highly distinguishable architectural appearance. Histopathological examination of the cardiac tissues in control mice presented clear integrity of myocardial membrane and normal fibers without any infarction as well as infiltration of inflammatory cells. On the other hand, heart degeneration and infiltration of lymphocytes were observed in heart sections from CTX alone pretreatment, while these changes were mitigated in the DBD-treated groups, especially in the DBD (12 g/kg) group. Notably, treatment with DBD markedly reduced the numbers of inflammatory cells in infarcted region, indicating that DBD attenuated the histopathology condition of CTX-stimulated heart toxicity (Figure
Histopathological examination of the heart tissues (x200). Tissues for histological analysis were formalin-fixed at room temperature and embedded in paraffin blocks were sliced into sections of 5 mm for being stained with (H&E).
To further assert the cardioprotective mechanism of DBD, the nonphosphorylated and phosphorylated forms of the NF-кB components were detected. Western blot analysis revealed that the exposure to CTX apparently upregulated the levels of p-NF-кBp65, p-IкB
Effects of DND on NF-кB pathway in heart tissues. Western blot analysis was used to measure the NF-кB pathway in heart tissues. All values given are the mean ± SD. #P<0.05 and ##P<0.01 versus control group.
Effects of DND on p-NF-кBp65 in heart by immunohistochemical (x200). Immunohistochemical analysis was used to measure the p-NF-кBp65 in heart tissues.
As depicted in Figure
As depicted in Figure
Effect of DBD on AST, ALT, CK, and LDH in heart by PCR. PCR analysis was used to measure the AST, ALT, CK, and LDH in heart tissues. All values given are the mean ± SD. #P<0.05 and ##P<0.01 versus control group.
Dangguibuxue decoction (DBD) containing Angelicae sinensis radix (Danggui) and Astragalus radix (Huangqi) at a ratio of 1:5 is characterized by anti-inflammation and antioxidantion, which can possibly exert a positive impact on the therapy method of cardiovascular diseases. This study was aimed at investigating the ameliorative effect of Dangguibuxue decoction (DBD) after treatment with the chemotherapeutic agent CTX. DBD significantly inhibited the serum levels of ALT, AST, CK, and LDH. In addition, DBD effectively decreased total numbers of WBCs and blood platelets and attenuated the histological change. Western blot analysis revealed that DBD ameliorated CTX-challenged heart injury possibly through the IKK/I
The cyclophosphamide (CTX), a highly acknowledged alkylating agent, has been frequently applied for the intervention of neoplastic disease, such as leukemia or lymphomas [
It is well known that the spleen plays essential roles in regard to the immune system [
The numbers of blood platelets, WBCs are the sensitive blood tests applied to the diagnosis the cardiac function in heart disease [
LDH is the specificity enzyme in the cytoplasm and releases into blood during myocardial dysfunction [
Hence, we examined the hypothesis that treatment with DBD reduced the production of IL-1
To further verify the property of the inhibitory effect of DBD on the secretion of inflammatory cytokine, we investigated the effects of DBD on the recruitment of the IKK/I
In conclusion, the present study demonstrated that the DBD administration apparently improved cardiac function after CTX-challenged heart toxicity in mice, suggesting a potential therapeutic role of DBD for the treatment of cardiovascular disorder. The cardioprotective effect of DBD might be attributed to its ability of suppressing biochemical indicators, which possibly partially occurred via the inhibition of the IKK/IкB/NF-кB pathway. Further studies are warranted to explore the clinical application of DBD in the future.
The data used to support the findings of this study are available from the corresponding author upon request.
The authors declare no conflicts of interest.
The present study was supported by grants from the Six Talent Peaks Project in Jiangsu Province, China (Grant no. 2014-YY-006), the China Postdoctoral Science Foundation of China (Grant no. 2013M541705), the Postdoctoral Research Foundation of Jiangsu Province, China (Grant no. 1301072C), the Science Foundation of Nantong City, Jiangsu Province, China (Grant no. MS32015016), the Natural Science Foundation of Jiangsu Province, China (Grant no. BK20171257), and the “333 Project” of Jiangsu Province, China (Grant no. BRA2017557).