Lycopene rich food and dark chocolate are among the best-documented products with a broad health benefit. This study explored the systemic effect of lycopene and dark chocolate (DC) on gut microbiota, blood, liver metabolism, skeletal muscle tissue oxygenation and skin. 30 volunteers were recruited for this trial, 15 women and 15 men with a mean age of 55 ± 5.7 years and with moderate obesity, 30 < BMI < 35 kg/m2. They were randomized and divided into five equal interventional groups: three received different formulations of lycopene, one of them with a 7 mg daily dose and two with 30 mg; another group was given 10 g of DC with 7 mg lycopene embedded into its matrix, and the last group received 10 g DC. The trial was double-blinded for the three lycopene groups and separately for the 2 DC groups; the trial lasted for 1 month. By the end of the trial there were dose-dependent changes in the gut microbiota profile in all three lycopene groups with an increase of relative abundance of, e.g.,
Carotenoids are essential micronutrients, which cannot be synthesized by humans and must be obtained from food. Lycopene, the red pigment of tomatoes, watermelon, and some other fruits, is one major carotenoids. Intake of lycopene rich food has been linked to lower prevalence of cardiovascular disease, stroke [
The concentration of lycopene in blood and body tissues is highly variable and depends on dietary habits and age and has also been related to health status. For example, the plasma or serum concentration could vary from about 60 ng/ml, or below, to 600 ng/ml or above [
The current consensus on the broad beneficial effects of lycopene on health exists with regard to its powerful antioxidant properties and the related protection of lipoproteins and other lipid structures from oxidative damage, which typically are associated with a number of pathological conditions [
It has been demonstrated that cocoa flavanols have a systemic effect in healthy volunteers with prebiotic activity on the gut microbiome and reduction of blood lipoproteins produced by the liver [
There were two formulations of GAL, for two different nutraceutical applications, which were applied in this study. The first was with a blend of MSFA to facilitate formation of small-medium chylomicrons, which would be transported by the portal vein for liver targeting delivery of lycopene. The second one was a blend with PUFA to facilitate formation of larger chylomicrons, which would be transported by the thoracic duct for the systemic blood circulation bypassing the liver. All GAL products were made in gelatin capsule.
For the control DC and DCL Green & Black’s 70% dark chocolate was used. It was made from Trinitario cocoa beans and contained 42% fat, of which saturates were 25%; carbohydrates 36.5%, of which sugars were 28.5%; fibre 10%, protein 9.1%, salt 0.13%. Each 10 g bar contained 1.5 mg of catechins, 6.6 mg of epicatechins, 1.9 mg of dimer-B2, 7.5 mg of caffeine, 75 mg of theobromine, 75
Both capsule and chocolate products were advised to be taken once a day after the main meal.
The duration of the trial was 1 month.
The treatment part of the study and the blood analysis were conducted at the Institute of Cardiology, the Ministry of Health of the Russian Federation (Saratov, Russian Federation) by Lycotec Ltd. (Cambridge, United Kingdom). The protocol was approved by the Local Ethics Committee (FGBU SarNIIK18.02.2014). Trial registration number was
The stool microbiota analysis was made by the Department of Food Science in the Section of Food Microbiology, at the University of Copenhagen in Denmark.
The skin samples were analysed by Lycotec in Cambridge.
ability to sign an informed consent, nonsmokers or light-to-moderate smokers (≤10 cigarettes daily), moderately obese with BMI between 30 and 35 kg/m2, with elevated serum markers of inflammatory oxidative damage, IOD ≥ 40 no participation in other dietary trials during the last 3 months before enrolment and duration of study, willingness and ability to comply with the study protocol for the duration of the study.
unwillingness to sign informed consent, unable to comply with the protocol for the duration of the study, history of myocardial infarction in the 3 months preceding the study, ejection fraction (EF) < 45%, significant medical condition that would impact safety considerations (e.g., significantly elevated liver enzymes, hepatitis, severe dermatitis, uncontrolled diabetes, cancer, severe GI disease, fibromyalgia, renal failure, recent CVA (cerebrovascular accident), pancreatitis, respiratory diseases, epilepsy, etc.), compulsive alcohol abuse (>10 drinks weekly), or regular exposure to other substances of abuse, participation in other nutritional or pharmaceutical studies, resting heart rate of >100 beats per minute or <50 beats per minute, positive test for tuberculosis, HIV, or hepatitis B, inability to tolerate phlebotomy, special diets in the 4 weeks prior to the study (e.g., liquid, protein, and raw food diet), tomato or DC intolerance.
Measurements of body mass index, BMI, body mass of the patients and their height were carried out in the morning and BMI was calculated in kg/m2. Pulse rate, systolic and diastolic blood pressure, SBP, and DBP were recorded three times on the left arm of the seated patient after 15 min of rest. The time between measurements was greater than 2 minutes. The mean result for each parameter was calculated. All body and vascular parameters were recorded in the morning between 8 and 10 am.
For sample collection from the surface of the facial skin and samples of the cerumen all study participants were requested to avoid facial and ear hygienic manipulations for 24 hours before sampling, which was carried out in the morning in parallel with blood sample collection. Skin surface sample collection and preparation were performed as previously described [
The stool samples were collected either on the morning or night before the day of the visit to the hospital. Participants did this collection themselves, at the convenience of their home, in the morning on the day of visiting clinic. A special kit and sample containers were provided by the trial team. The collected samples were labeled and stored at −80°C until analysis.
Genomic DNA was extracted from 200 mg stomached fecal material (stomacher 2x 60 sec at mid speed) using the Power Soil Kit protocol (MoBio Laboratories). The FastPrep bead-beating step was performed in 3 cycles of 15 s each at a speed of 6.5 M/s in a FastPrep-24TM Homogenizer (MP). DNA quantity and quality were measured using a NanoDrop 1000 (Thermo Scientific), 16S rRNA gene library preparation. The fecal microbiota composition was determined using tag-encoded 16S rRNA gene MiSeq-based (Illumina, CA, USA) high throughput sequencing. In brief the V3 region of the 16S rRNA gene was amplified using primers compatible with the Nextera Index Kit (Illumina) NXt_338_F:5′- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGACWCCTACGGGWGGCAGCAG -3′ and NXt_518_R: 5′- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGATTACCGCGGCTGCTGG -3′.. [
The raw dataset containing pair-ended reads with corresponding quality scores were merged and trimmed using fastq_mergepairs and fastq_filter scripts implemented in the UPARSE pipeline. The minimum overlap length was set to 10 base pairs (bp). The minimum length of merged reads was 150 bp, the maximum expected error E was 2.0, and the first truncating position with a quality score was N≤4. Purging the dataset from chimeric reads and constructing de novo Operational Taxonomic Units (OTU) was conducted using the UPARSE pipeline [
Baseline characteristics of the participants are presented in Table
Baseline values.
BASELINE CHARACTERISTICS OF THE ENROLLED VOLUNTEERS | |||||
---|---|---|---|---|---|
Groups | |||||
I | II | III | IV | V | |
Number of Patients | 6 | 6 | 6 | 6 | 6 |
| |||||
Males | 3 | 2 | 4 | 3 | 3 |
| |||||
Females | 3 | 4 | 2 | 3 | 3 |
| |||||
Age | 61.8±5.9 | 56.2±5.9 | 56.1±5.8 | 52.1±5.1 | 63.2±6.1 |
| |||||
Light/Moderate Smokers | 1 | 1 | 1 | 1 | 1 |
| |||||
Body Mass Index in kg/m2 | 32.1±2.4 | 32.7±3.3 | 33.8±3.5 | 31.1±3.2 | 31.8±2.9 |
| |||||
Fasting Glucose mmol/dL | 6.1±0.42 | 6.0±0.45 | 5.7±0.49 | 5.4±0.43 | 5.5±0.56 |
| |||||
Total Cholesterol mg/dL | 185 ± 14.3 | 181 ± 15.2 | 175 ± 14.7 | 187 ± 16.2 | 180 ± 13.9 |
| |||||
Triglycerides mg/dl | 135±14.9 | 136±13.8 | 136±13.8 | 127±13.1 | 122±13.5 |
| |||||
LDL mg/dL | 144±11.8 | 143±12.7 | 121±12.2 | 137±13.6 | 131±12.1 |
| |||||
HDL mg/dL | 41.9±3.2 | 46.5±4.4 | 51.2±4.7 | 49.8±4.4 | 44.0±4.4 |
| |||||
Pulse rate per min | 66.7±4.2 | 67.7±3.5 | 65.2±3.4 | 70.5±3.9 | 66.6±5.1 |
| |||||
Blood Pressure | |||||
| |||||
Systolic | 112±5.5 | 123±7.4 | 117±6.9 | 124±8.5 | 118±6.7 |
| |||||
Diastolic | 77.6±4.4 | 78.7±5.0 | 77.6±4.4 | 76.7±4.6 | 79±5.6 |
Ingestion of lycopene products for one month, either in the capsule format or in the chocolate matrix, resulted in a significant increase of its concentration both in the serum and in the ear skin excretion (Table
Changes in blood and tissue parameters after supplementation with GA lycopene for one month.
Parameters before and after 4 weeks of the trial | Groups | ||||
---|---|---|---|---|---|
I | II | III | IV | V | |
Lycopene in serum, in ng/ml | |||||
before | 110 ± 17 | 110 ± 12 | 210 ± 19 | 90 ± 8.4 | 120 ± 22 |
after | 500 ± 52 | 310 ± 30 | 430 ± 30 | 190 ± 14 | 170 ± 27 |
| |||||
Lycopene in cerumen, in ng/g | |||||
before | 53 ± 9.5 | 40 ± 5.5 | 70 ± 10.2 | 750 ± 93 | 14 ± 7.6 |
after | 102 ± 12.4 | 100 ± 12.5 | 90 ± 11.5 | 2,500 ± 237 | 12 ± 5.5 |
| |||||
Triglycerides mg/dL | |||||
before | 135±14.9 | 155 ± 12.1 | 128 ± 9.7 | 126 ± 10.2 | 122±13.5 |
after | 133± 11.5 | 150 ± 11.3 | 110 ± 8.5 | 123 ± 10.1 | 118 ± 11.7 |
| |||||
LDL, in mg/dL | |||||
before | 144±12.5 | 143 ± 12.4 | 121 ± 10.5 | 137 ± 11.7 | 131±12.1 |
after | 139 ± 10.1 | 134 ± 11.2 | 104 ± 9.8 | 124 ± 10.3 | 129 ± 10.2 |
| |||||
HDL, in mg/dL | |||||
before | 41.9±2.9 | 46.5 ± 3.7 | 49.8 ± 3.9 | 50.1 ± 4.2 | 44.0±2.2 |
after | 42.2 ± 3.1 | 47.8 ± 3.9 | 50.0 ± 4.6 | 51.2 ± 4.4 | 45.1 ± 2.4 |
| |||||
IOD, in | |||||
before | 142 ± 9.2 | 141 ± 12.7 | 115 ± 10.9 | 164 ± 5.8 | 177 ± 12.1 |
after | 101 ± 8.7 | 92 ± 8.8 | 46 ± 4.5 | 42 ± 3.7 | 153 ± 11.9 |
| |||||
LDL-Px, in ELISA × 103 | |||||
before | 310 ± 29 | 550 ± 61 | 664 ± 63 | 420 ± 45 | 450 ± 41 |
after | 250 ± 24 | 350 ± 29 | 379 ± 34 | 130 ± 12 | 370 ± 32 |
| |||||
Lipoprotein O2, in | |||||
before | 4.07 ± 0.29 | 3.89 ± 0.35 | 3.86 ± 0.32 | 3.07 ± 0.29 | 3.67 ± 0.31 |
after | 5.26 ± 0.33 | 4.64 ± 0.33 | 4.55 ± 0.39 | 3.44 ± 0.27 | 5.27 ± 0.39 |
| |||||
StO2, in AUC mm | |||||
before | 81 ± 6.4 | 66 ± 5.2 | 67 ± 5.1 | 59 ± 4.4 | 76 ± 5.5 |
after | 88 ± 6.9 | 79 ± 6.1 | 83 ± 7.1 | 79 ± 6.3 | 76 ± 6.3 |
Supplementation with GAL-MSFA resulted in a dose-dependent significant reduction of markers of oxidative damage and inflammation. 7 mg of lycopene was able to reduce IOD and LDL-Px, by the end of the month, by 49
DC with or without lycopene had a similar effect on the inhibition of IOD as 7 mg of lycopene. Although both chocolate products were able to reduce LDL-Px, their effectiveness was below that of lycopene itself.
Administration of either formulation of GAL, or lycopene with DC complex, resulted in significant changes in the profile of fasting lipoproteins, which are assembled and produced by the liver. GAL-MSFA reduced in a dose-dependent manner both LDL concentration and triglycerides. This liver targeting formulation of lycopene, in 30 mg dose, was able to reduce the first parameter by 17 mg/dL and the second by 18 mg/dL. Supplementation with GAL-PUFA resulted in LDL reduction by 13 mg/dL and triglycerides by only 3 mg/dL. Lycopene in the L-Tug complex with dark chocolate was also able to reduce LDL; however, changes caused by the ingestion of the control DC were not significant (Table
By the end of the trial there were no changes in the serum concentration of HDL, glucose and liver enzymes, ALT and AST (results are not presented).
There were noticeable improvements in the molecular oxygen metabolism in all groups. In groups supplemented with GAL-MSFA O2 concentration and its transportation by blood lipoproteins was significantly increased by 18-19%, p < 0.05. In the group that received GAL-PUFA this increase was lower, by 12%, p > 0.05. In the group, which received control DC, the increase in the lipoprotein O2 was the highest, by 44%, p <0.01.
These changes in the plasma oxygen transportation translated to benefit for peripheral tissue oxygenation but not in the control DC group. Ingestion of all lycopene products also resulted in a significant boost of tissue oxygenation in skeletal muscles. Administration of GAL-MSFA demonstrated a dose-dependent effect in changes of this parameter. However, 30 mg of lycopene in GAL-PUFA formulation was 25%, p <0.05, more effective than the same dose of lycopene but in the GAL-MSFA formulation (Table
Supplementation of the participants with all formulations of lycopene for one month resulted in significant reversal of age-associated parameters of sebum and corneocytes. Also for the GAL-PUFA a reduction was observed, though statistically not significant. The GAL-PUFA formulation was more effective in improving cellular parameters of the skin, while GAL-MSFA was more effective for sebum parameters.
However, different to the blood parameters, observed changes in the skin, apart from those related to the sebum, did not have dose-dependency. This may indicate that even the dose of 7 mg of daily supplementation with lycopene was sufficient to reach its saturated level in this tissue by the end of the trial.
The viscosity of the sebum, in terms of the size of the lipid droplets collected from the surface of the skin, was increased on average by 390 nm during this trial after supplementation by all formulations of lycopene. However, GAL-PUFA only slightly increased the diameter of the droplets, by 50 nm, while GAL-MSFA was much more effective and did it in a dose-dependent manner, by 180 nm for 7 mg of lycopene and by 480 nm for 30 mg (Table
Changes in sebum, and corneocyte parameters of the skin after supplementation with GA lycopene for one month.
Parameters before and after 4 weeks of trial | Groups with GA Lycopene supplementation | ||||
---|---|---|---|---|---|
I | II | III | IV | V | |
Sebum droplet size, in | |||||
before | 4.6 ± 1.11 | 3.96 ± 0.17 | 3.72 ± 0.43 | 3.89 ± 0.21 | 4.9 ± 0.53 |
after | 5.1 ± 0.75 | 4.14 ± 0.11 | 4.20 ± 0.88 | 3.94 ± 0.22 | 4.9 ± 0.57 |
| |||||
Corneocyte exfoliation rate§ | |||||
before | 66 ± 6.8 | 82 ± 7.8 | 83 ± 9.3 | 87 ± 9.5 | 61 ± 6.2 |
after | 63 ± 6.2 | 73 ± 12.0 | 76 ± 7.7 | 67 ± 13.5 | 60 ± 6.9 |
| |||||
Corneocyte damage | |||||
before | 4.2 ± 0.98 | 7.19 ± 2.47 | 3.40 ± 0.97 | 3.50 ± 1.16 | 2.0 ± 1.98 |
after | 2.5 ± 0.43 | 3.80 ± 1.23 | 2.41 ± 0.76 | 2.17 ± 0.52 | 1.8 ± 1.23 |
Changes in skin parameters after supplementation with 7 mg of GA lycopene for one month. Typical skin smear samples: lipid droplets of the sebum were stained with Oil Red O, and corneocytes with hematoxylin, eosin at 1,000× magnification.
Sebum
Exfoliated corneocytes
The rate of corneocyte exfoliation was reduced by about 23% for the former formulation and by 9-11% for the latter. Moreover, not just the rate of exfoliation was reduced by lycopene supplementation but also the damage of these cells too. The number of the clusters of cross-linked corneocytes was reduced by 36% for GAL-PUFA and by 29 to 47% by GAL-MSFA (Table
It was interesting to observe that these improvements of the sebum (Figure
In the control DC group the sebum and corneocytes parameters by the end of the trial were not affected.
After 4 weeks of supplementation with GA lycopene, a shift in the gut microbial communities was detected in the stool of the participants. The relative abundance of OTUs on Phyla level changed to increased relative abundance in Actinobacteria in all intervention groups, Group IV (30mg lycopene liver targeting) 4.5%- 7.12%, Group II (7mg lycopene capsule) 2.52%- 2.85%, and a significant increase was detected for Group III (30 mg lycopene cardiovascular targeting) with 1.12%- 3.22% p=0.04 (FDR corrected)(Figure
Bacterial relative abundance (Phylum level) of the different intervention groups before and after the 4 weeks of intervention as determined by 16S rRNA gene amplicon sequencing. (Group I) fortified with 7 mg lycopene - 10 g dark chocolate 7 mg DCL, (Group II) 7 mg of lycopene in a capsule 7 mg GAL-MSFA, (Group III) 30 mg of lycopene in cardiovascular GAL-MSFA, (Group IV) 30 mg lycopene liver targeting/liver health GAL-PUFA. (Group V) 10 g of dark chocolate DC.
An increased dose of lycopene 30 mg Group III and IV versus Group II, 7 mg, was also reflected in an increased relative abundance of Actinobacteria (+2.6 Group IV, Group III +2.1%, Group II +0.33%). Bacteroidetes decreased in the relative abundance in all groups even though not being statistically significant (Group IV 4.92%-2.72%, Group III 12.4% to 7.2%, Group II 31.3% to 21.1%), p >0.5 (FDR corrected). No significant changes were detected for the remaining GM composition on Phyla level.
Relative abundances on the OTU species level at week 0 and week 4 for the GAL intervention groups (Group II, III, IV) with regard to formulations and dose effect are shown in Table
Average relative species compositions of gut microbial communities for the intervention groups 7 mg GAL-MSFA, 30 mg GAL-MSFA, 30 GAL-PUFA at different doses at the beginning and at the end of the intervention study.
7 mg | GAL MSFA | 30 mg | GAL MSFA | 30 mg | GAL PUFA | ||||
---|---|---|---|---|---|---|---|---|---|
Phyla | Family | Genera | Species | II_Day_0 | II_Week_4 | III_Day_0 | III_Week_4 | IV_Day_0 | IV_Week_4 |
Bacteroidetes | Porphyromonadaceae | | | 0,36 | 0,09 | 0,04 | 0,04 | 0,04 | 0,05 |
Bacteroidetes | S24-7 | 0,73 | 1,72 | 0,15 | 0,48 | 0,07 | 0,2 | ||
Bacteroidetes | Porphyromonadaceae | | 0,33 | 0,1 | 0,68 | 0,09 | 0,05 | 0,24 | |
Bacteroidetes | [Paraprevotellaceae] | | 0,11 | 0,05 | 0,26 | 0,03 | 0,01 | 0 | |
Bacteroidetes | Bacteroidaceae | | 8,59 | 2,58 | 0,91 | 3,14 | 0,74 | 0,95 | |
Bacteroidetes | Bacteroidaceae | | | 0,08 | 0,04 | 0,03 | 0,02 | 0,01 | 0 |
Bacteroidetes | 0,77 | 1,14 | 0,31 | 0 | 0,08 | 0,02 | |||
Bacteroidetes | Prevotellaceae | | | 13,52 | 12,2 | 8,52 | 0,38 | 0,8 | 0,13 |
Bacteroidetes | Bacteroidaceae | | | 0,09 | 0,01 | 0,02 | 0,01 | 0 | 0 |
Bacteroidetes | Bacteroidaceae | | | 0,15 | 0,04 | 0,04 | 0,1 | 0,09 | 0,26 |
Bacteroidetes | Prevotellaceae | | 0,26 | 0,19 | 0,38 | 0 | 0,2 | 0 | |
Bacteroidetes | Prevotellaceae | | | 1,24 | 0,52 | 0,15 | 0 | 0,11 | 0,03 |
Bacteroidetes | Rikenellaceae | 2,18 | 0,57 | 0,2 | 1,33 | 0,34 | 0,39 | ||
Bacteroidetes | Bacteroidaceae | | | 0,49 | 0,99 | 0,15 | 1,22 | 2 | 0,01 |
Bacteroidetes | [Odoribacteraceae] | | 0,08 | 0,03 | 0,03 | 0,04 | 0,02 | 0,01 | |
Bacteroidetes | [Paraprevotellaceae] | | 1,16 | 0,5 | 0,21 | 0 | 0,04 | 0,02 | |
Bacteroidetes | [Barnesiellaceae] | 0,71 | 0,07 | 0,02 | 0,1 | 0,05 | 0,06 | ||
Bacteroidetes | Bacteroidaceae | | | 0,24 | 0,03 | 0,08 | 0,11 | 0,03 | 0,34 |
| |||||||||
Actinobacteria | Bifidobacteriaceae | | | 0,09 | 0,11 | 0,04 | 0,16 | 0,11 | 0,16 |
Actinobacteria | Bifidobacteriaceae | | 0,15 | 0,54 | 0,03 | 0,5 | 0,73 | 2,31 | |
Actinobacteria | Bifidobacteriaceae | | | 0,33 | 1,09 | 0,05 | 0,24 | 0,69 | 2,93 |
Actinobacteria | Actinomycetaceae | | 0,02 | 0,01 | 0,04 | 0,35 | 0,04 | 0,02 | |
Actinobacteria | Coriobacteriaceae | | | 0 | 0 | 0,02 | 0,03 | 0,01 | 0,01 |
Actinobacteria | Coriobacteriaceae | | | 0,01 | 0 | 0,01 | 0,02 | 0,09 | 0,07 |
Actinobacteria | Coriobacteriaceae | | 0,01 | 0,01 | 0,01 | 0,09 | 0,02 | 0,02 | |
Actinobacteria | Coriobacteriaceae | | | 0,96 | 0,58 | 0,59 | 1,2 | 1,57 | 0,94 |
Actinobacteria | Coriobacteriaceae | 0,83 | 0,41 | 0,21 | 0,27 | 0,91 | 0,52 | ||
Actinobacteria | Coriobacteriaceae | | 0,02 | 0,01 | 0,06 | 0,1 | 0,09 | 0,07 | |
Actinobacteria | Coriobacteriaceae | | 0,09 | 0,09 | 0,07 | 0,1 | 0,23 | 0,04 | |
| |||||||||
Firmicutes | Veillonellaceae | | 0,3 | 0,82 | 1,54 | 0,09 | 1,2 | 7,23 | |
Firmicutes | Lachnospiraceae | | 0,04 | 0,02 | 0,02 | 0,04 | 0,03 | 0,11 | |
Firmicutes | Clostridiaceae | | 0,01 | 0 | 0,01 | 0,04 | 0,1 | 0 | |
Firmicutes | Streptococcaceae | | 0,13 | 0,21 | 0,8 | 8,14 | 0,19 | 2,26 | |
Firmicutes | Clostridiaceae | 0,95 | 0,75 | 0,82 | 4,8 | 5,63 | 0,94 | ||
Firmicutes | Lachnospiraceae | | 0,08 | 0,14 | 0,04 | 0,03 | 0,09 | 0,05 | |
Firmicutes | 6,99 | 6,64 | 16,32 | 10,2 | 8,45 | 5,98 | |||
Firmicutes | Clostridiaceae | | | 0,03 | 0,01 | 0,03 | 0,22 | 0,53 | 0,04 |
Firmicutes | Lachnospiraceae | | | 0,01 | 0,01 | 0,02 | 0 | 0 | 0,01 |
Firmicutes | Lachnospiraceae | | | 0,04 | 0,04 | 0,05 | 0,06 | 0,13 | 0,06 |
Firmicutes | Lachnospiraceae | | | 0,86 | 0,68 | 1,09 | 1,02 | 1,72 | 2,23 |
Firmicutes | Lachnospiraceae | | 3,08 | 2,23 | 3,78 | 4,24 | 7,24 | 9,07 | |
Firmicutes | Lachnospiraceae | | | 0,13 | 0,22 | 0,36 | 0,15 | 0,15 | 0,15 |
Firmicutes | Ruminococcaceae | | | 1,39 | 2,42 | 1,04 | 1 | 0,98 | 1,13 |
Firmicutes | Veillonellaceae | | 0,39 | 0,17 | 0,04 | 0,02 | 3,69 | 0,01 | |
Firmicutes | Ruminococcaceae | 20,99 | 30,92 | 25,11 | 15,39 | 20,02 | 23,35 | ||
Firmicutes | Other | | | 1,31 | 0,77 | 1,59 | 6,12 | 4,79 | 1,8 |
Firmicutes | Streptococcaceae | | | 0,01 | 0 | 0,02 | 0,08 | 0 | 0,11 |
Firmicutes | Lachnospiraceae | | 0,2 | 0,31 | 0,17 | 0,19 | 0,26 | 0,17 | |
Firmicutes | Erysipelotrichaceae | 0,08 | 0,04 | 0,02 | 0,09 | 0,2 | 0,05 | ||
Firmicutes | Christensenellaceae | 0,23 | 0,28 | 0,18 | 0,04 | 0,93 | 0,24 | ||
Firmicutes | Lachnospiraceae | | 0,12 | 0,1 | 0,13 | 0,15 | 0,18 | 0,21 | |
Firmicutes | Clostridiaceae | | 0,32 | 0,45 | 0,3 | 0,42 | 0,3 | 0,27 | |
Firmicutes | Lachnospiraceae | 7,01 | 8,06 | 8,82 | 7,27 | 9,5 | 8,18 | ||
Firmicutes | Ruminococcaceae | | 1,71 | 1,44 | 1,69 | 2,56 | 1,98 | 1,66 | |
Firmicutes | Erysipelotrichaceae | | | 0,53 | 0,27 | 0,38 | 1,03 | 0,78 | 0,09 |
Firmicutes | Lachnospiraceae | | 0,25 | 0,11 | 0,23 | 0,04 | 0,23 | 0,21 | |
Firmicutes | [Mogibacteriaceae] | 0,17 | 0,11 | 0,06 | 0,08 | 0,29 | 0,11 | ||
Firmicutes | Lachnospiraceae | | | 4,85 | 5,88 | 5,46 | 4,67 | 7,47 | 6,19 |
Firmicutes | Lachnospiraceae | | 1,78 | 2,07 | 2,2 | 2,56 | 3,41 | 3,43 | |
Firmicutes | Ruminococcaceae | | 1,85 | 2,11 | 4,7 | 2,11 | 1,49 | 4,73 | |
Firmicutes | Lachnospiraceae | | 1,88 | 2,8 | 1,77 | 2,15 | 2,76 | 2,13 | |
Firmicutes | Ruminococcaceae | | | 5,54 | 3,82 | 2,47 | 1,85 | 0,62 | 3,46 |
Firmicutes | Erysipelotrichaceae | | 0,63 | 0,38 | 2,25 | 1,18 | 2,4 | 2,88 | |
| |||||||||
Proteobacteria | Desulfovibrionaceae | | 0,02 | 0,01 | 0,01 | 0,01 | 0,11 | 0,02 | |
Proteobacteria | Enterobacteriaceae | 0,66 | 0,74 | 0,33 | 9,8 | 0,95 | 0,08 | ||
Proteobacteria | Alcaligenaceae | | 0,04 | 0,06 | 0,01 | 0 | 0,01 | 0 | |
| |||||||||
Verrucomicrobia | Verrucomicrobiaceae | | | 0,17 | 0,12 | 1,49 | 0,13 | 0,72 | 0,91 |
| |||||||||
Tenericutes | 0,19 | 0,12 | 0,2 | 0,08 | 0,01 | 0,21 | |||
| |||||||||
TM7 | 0 | 0 | 0,01 | 0,01 | 0,02 | 0,01 | |||
| |||||||||
Cyanobacteria | 0,01 | 0,01 | 0,01 | 0,01 | 0,03 | 0,02 |
It is evident that three different OTUs (species level cut-off), namely, OTUs representing Bifidobacterium species increased in relative abundance; these were Bifidobacterium longum, B. adolescentis, and an assigned species.
Whereas several OTUs belonging to the Prevotella genera had decreased in relative abundance over the course of the intervention, the statistically insignificant decrease in Bacteroidetes by GAL formulations seems hence to be genera specific (Table
Looking at Groups I, II, and V the DC and DC-GAL (7 mg) and GAL-MSFA (7 mg) on the Phyla level we have detected a decreased relative abundance of Actinobacteria 4.4-3.4%, though not statistically significant (p>0.9) for the DC intervention; no significant changes were detected in the relative abundance of Bacteroidetes 6.4%-6.3%, Proteobacteria 6.6 -2.4% (p>0.9) for this intervention group after 4 weeks of DC intervention.
Whereas the relative abundance of Actinobacteria increased in the DC-GAL group (I) from 1.9% to 3.3% after 4 weeks of intervention, Bacteroidetes on the other hand increased slightly from 23.4 to 25.8%, Firmicutes decreased 71.7-67.8%, Proteobacteria decreased from 0.49 to 0.24%, p>0.4; these changes were not statistically significant. The relative abundance of bacteria on the species level of the DC intervention and 7 mg GAL-DC versus GAL-MSFA formulations can be seen in Table
Average relative species compositions of gut microbial communities for the intervention groups 7 mg DCL, 7 mg GAL-MSFA and DC at the beginning and at the end of the intervention study.
7 mg_DCL | 7 mg_DCL | 7 mg_GAL-MSFA | 7 mg_GAL-MSFA | DC | DC | ||||
---|---|---|---|---|---|---|---|---|---|
I_Day_0 | I_Week_4 | II_Day_0 | II_Week_4 | V_Day_0 | V_Week_4 | ||||
Bacteroidetes | Bacteroidaceae | | | 1,08 | 0,21 | 0,15 | 0,04 | 0,12 | 0,04 |
Bacteroidetes | Bacteroidaceae | | | 1,71 | 0,41 | 0,24 | 0,03 | 0,21 | 0,07 |
Bacteroidetes | Bacteroidaceae | | 7,54 | 1,84 | 8,60 | 2,57 | 1,64 | 0,57 | |
Bacteroidetes | Bacteroidaceae | | | 1,43 | 0,17 | 0,01 | 0,00 | 0,30 | 0,00 |
Bacteroidetes | Prevotellaceae | | | 2,05 | 22,30 | 13,55 | 12,19 | 0,28 | 2,72 |
Bacteroidetes | [Odoribacteraceae] | | 0,11 | 0,01 | 0,08 | 0,03 | 0,06 | 0,01 | |
Bacteroidetes | Porphyromonadaceae | | | 0,46 | 0,07 | 0,36 | 0,09 | 0,13 | 0,05 |
Bacteroidetes | Porphyromonadaceae | Parabacteroides | 0,48 | 0,05 | 0,33 | 0,10 | 0,26 | 0,32 | |
TM7 | 0,02 | 0,00 | 0,01 | 0,00 | 0,00 | 0,01 | |||
Bacteroidetes | S24-7 | 0,00 | 0,00 | 0,72 | 1,71 | 1,55 | 1,56 | ||
Bacteroidetes | [Paraprevotellaceae] | | 0,58 | 0,05 | 0,11 | 0,05 | 0,04 | 0,00 | |
Bacteroidetes | Bacteroidaceae | | | 0,08 | 0,03 | 0,08 | 0,04 | 0,09 | 0,00 |
Bacteroidetes | Bacteroidaceae | | | 0,09 | 0,01 | 0,09 | 0,01 | 0,04 | 0,01 |
Bacteroidetes | [Barnesiellaceae] | 0,22 | 0,06 | 0,70 | 0,07 | 0,03 | 0,01 | ||
Bacteroidetes | Prevotellaceae | | | 0,02 | 0,00 | 1,25 | 0,52 | 0,09 | 0,13 |
Bacteroidetes | Prevotellaceae | | 0,42 | 0,00 | 0,27 | 0,19 | 0,08 | 0,64 | |
Bacteroidetes | Rikenellaceae | 1,12 | 0,58 | 2,18 | 0,57 | 0,38 | 0,08 | ||
| |||||||||
Actinobacteria | Coriobacteriaceae | | | 0,47 | 0,70 | 0,95 | 0,57 | 0,24 | 0,57 |
Actinobacteria | Coriobacteriaceae | | 0,02 | 0,06 | 0,09 | 0,09 | 0,07 | 0,15 | |
Actinobacteria | Bifidobacteriaceae | | | 0,06 | 0,62 | 0,33 | 1,09 | 1,13 | 0,58 |
Actinobacteria | Bifidobacteriaceae | | | 0,37 | 0,83 | 0,09 | 0,11 | 0,23 | 0,08 |
Actinobacteria | Bifidobacteriaceae | | 0,66 | 0,42 | 0,16 | 0,54 | 1,29 | 0,41 | |
Actinobacteria | Coriobacteriaceae | 0,20 | 0,52 | 0,83 | 0,41 | 1,36 | 1,50 | ||
Actinobacteria | Coriobacteriaceae | | 0,03 | 0,03 | 0,02 | 0,01 | 0,03 | 0,05 | |
Actinobacteria | Coriobacteriaceae | | 0,01 | 0,01 | 0,01 | 0,01 | 0,01 | 0,02 | |
Actinobacteria | Actinomycetaceae | | 0,03 | 0,04 | 0,02 | 0,01 | 0,02 | 0,04 | |
| |||||||||
Firmicutes | Ruminococcaceae | | 1,52 | 1,01 | 1,86 | 2,11 | 1,45 | 1,92 | |
Firmicutes | Clostridiaceae | | 0,50 | 0,29 | 0,32 | 0,45 | 0,61 | 0,75 | |
Firmicutes | Lachnospiraceae | | 0,10 | 0,12 | 0,12 | 0,10 | 0,07 | 0,09 | |
Firmicutes | 7,10 | 7,06 | 6,98 | 6,65 | 5,43 | 5,16 | |||
Firmicutes | Lachnospiraceae | | 2,19 | 2,06 | 1,78 | 2,06 | 1,66 | 1,76 | |
Firmicutes | Ruminococcaceae | | 0,83 | 1,10 | 5,54 | 3,82 | 0,87 | 0,54 | |
Firmicutes | Clostridiaceae | 1,88 | 0,99 | 0,95 | 0,75 | 0,58 | 0,94 | ||
Firmicutes | Lachnospiraceae | | 1,22 | 1,61 | 0,87 | 0,68 | 1,37 | 1,49 | |
Firmicutes | Christensenellaceae | 0,51 | 0,52 | 0,23 | 0,27 | 0,36 | 1,61 | ||
Firmicutes | Other | | 1,55 | 1,29 | 1,31 | 0,78 | 1,06 | 1,22 | |
Firmicutes | Erysipelotrichaceae | | 0,10 | 0,79 | 0,63 | 0,38 | 0,83 | 1,11 | |
Firmicutes | Lachnospiraceae | | 0,10 | 0,05 | 0,08 | 0,14 | 0,20 | 0,25 | |
Firmicutes | Ruminococcaceae | | | 0,22 | 0,10 | 0,07 | 0,03 | 0,00 | 0,02 |
Firmicutes | Lachnospiraceae | | 3,78 | 5,86 | 3,08 | 2,24 | 4,21 | 4,65 | |
Firmicutes | Veillonellaceae | | 1,08 | 1,00 | 0,30 | 0,82 | 3,64 | 1,25 | |
Firmicutes | Ruminococcaceae | | | 2,21 | 3,35 | 1,39 | 2,43 | 2,00 | 2,34 |
Firmicutes | Ruminococcaceae | | 1,22 | 1,24 | 1,71 | 1,44 | 2,63 | 1,02 | |
Firmicutes | Erysipelotrichaceae | 0,06 | 0,06 | 0,08 | 0,04 | 0,06 | 0,02 | ||
Firmicutes | Streptococcaceae | S | 0,36 | 0,59 | 0,13 | 0,21 | 0,26 | 3,29 | |
Firmicutes | Lactobacillaceae | | 0,02 | 0,01 | 0,00 | 0,02 | 0,02 | 0,14 | |
Firmicutes | Ruminococcaceae | 20,67 | 19,42 | 20,96 | 30,93 | 33,04 | 26,33 | ||
Firmicutes | Lachnospiraceae | | | 0,01 | 0,01 | 0,01 | 0,01 | 0,01 | 0,02 |
Firmicutes | [Mogibacteriaceae] | 0,04 | 0,05 | 0,18 | 0,11 | 0,09 | 0,11 | ||
Firmicutes | Lachnospiraceae | | | 0,06 | 0,04 | 0,04 | 0,04 | 0,05 | 0,07 |
Firmicutes | Erysipelotrichaceae | | | 0,01 | 0,00 | 0,59 | 0,09 | 0,08 | 0,07 |
Firmicutes | Lachnospiraceae | | 0,04 | 0,04 | 0,04 | 0,02 | 0,05 | 0,09 | |
Firmicutes | Lachnospiraceae | | 3,64 | 2,31 | 1,87 | 2,81 | 1,61 | 3,00 | |
Firmicutes | Veillonellaceae | | | 0,04 | 0,05 | 0,01 | 0,03 | 0,16 | 0,27 |
Firmicutes | Veillonellaceae | | 0,22 | 0,12 | 0,39 | 0,17 | 0,08 | 0,01 | |
Firmicutes | Lachnospiraceae | | 0,27 | 0,17 | 0,20 | 0,30 | 0,24 | 0,41 | |
Firmicutes | Clostridiaceae | | | 0,06 | 0,03 | 0,03 | 0,01 | 0,01 | 0,01 |
Firmicutes | Lachnospiraceae | | | 0,53 | 0,37 | 0,13 | 0,22 | 0,21 | 0,25 |
Firmicutes | Lachnospiraceae | | 0,73 | 0,36 | 0,25 | 0,11 | 0,44 | 0,84 | |
Firmicutes | Lachnospiraceae | | | 7,50 | 5,93 | 4,84 | 5,90 | 6,08 | 10,35 |
Firmicutes | Erysipelotrichaceae | | | 0,14 | 0,13 | 0,53 | 0,27 | 0,09 | 0,32 |
Firmicutes | Lachnospiraceae | 11,09 | 9,48 | 7,01 | 8,05 | 6,73 | 9,18 | ||
| |||||||||
Proteobacteria | Enterobacteriaceae | 0,35 | 0,08 | 0,67 | 0,74 | 2,51 | 0,65 | ||
Proteobacteria | Alcaligenaceae | | 0,07 | 0,04 | 0,04 | 0,06 | 0,03 | 0,19 | |
Proteobacteria | Desulfovibrionaceae | | 0,01 | 0,01 | 0,02 | 0,01 | 0,02 | 0,01 | |
| |||||||||
Tenericutes | 0,14 | 0,16 | 0,18 | 0,12 | 0,40 | 1,44 | |||
| |||||||||
Verrucomicrobia | Verrucomicrobiaceae | | | 2,02 | 2,68 | 0,17 | 0,12 | 5,41 | 4,58 |
There were no significant correlations between the tested parameters and taxa relative abundance (raw OTU level nor summarized to the species level). No relationship between the bacterial relative abundance and host parameters could be found using the redundancy analysis (Figure
PCoA score plot of tag-encoded 16S rRNA gene amplicon sequencing data based on generalized UniFrac distance metrics (
Interconnection between intestine and its flora, liver metabolism and the skin is the subject of intensive investigations [
Development of metabolic syndrome, age associated skeletal muscle loss and frailty are accompanied by ongoing, often at a subclinical level, processes of inflammatory and oxidative damage, which may lead to changes in liver metabolism, vascular functions, increased body mass and development of subclinical systemic tissue hypoxia [
It was observed that supplementation with lycopene can increase its level in the skin tissue, which results in improving its protection from UV damage [
Sebum is not only essential for skin lubrication, which prevents it from dehydration, but is also an important part of its immune system and its antibacterial acid mantle.
The sebum is also supplying antioxidants and perhaps other beneficial molecules to the surface of the skin [
Continuous ingestion of DC had also a significant positive effect on liver associated markers of IOD and LDL-Px and also on the concentration of lipoprotein transported O2. However, these positive changes were not translated in improvement of skeletal muscle respiration and analysed skin parameters.
The absence of any direct correlations between relative abundance of gut taxa and analysed parameters of the blood, skeletal muscle and skin indicates a complex intertwined relationship between gut microbiome environment and the host metabolic pathways.
Prebiotics are traditionally considered to be non-digestable food ingredients, which can reach the intestine and be selectively utilized by host microorganisms conferring a health benefit [
There are a number of molecules within food, which are not fully digestible; hence, they can reach the colon and its microbiota. Carotenoids and lycopene in particular belong to these types of partially digestible molecules [
In our study we observed that regular intake for one month middle-aged mildly obese persons of lycopene, either in the GA formulations or in L-Tug chocolate resulted in significant changes in the profile of the gut microbiota.
GAL formulations led to a dose-dependent increase of members of the Phyla Actinobacteria, mainly driven by an increase in the relative abundance of
Bifidobacteria are one of the best studied genera of beneficial bacteria and often marketed as probiotics, presumably conferring a broad range of health benefits not only in the gut environment but in the whole body. This involves their ability to control bacterial and viral pathogens, stimulate local intestinal and systemic immune system, and improve lipid metabolism and weight management [
There is emerging evidence that dysbiosis of the gut microbiome and alteration of the associated bacterial gene pool and metabolic pathways may contribute to the development of pathogenesis of obesity [
In our study we observed that continuous intervention with GAL, DC, and DCL resulted in significant decrease in the abundance of Bacteroidetes. This could be explained either by direct action of this carotenoid, or its indirect activity via stimulation of some species of
It was interesting that observed lycopene effects on the gut bacteria, blood markers of inflammation and oxidation, lipids produced by the liver and by the skin (sebum) and peripheral tissue oxygenation were all dose-dependent.
This indicates that the observed complex of positive systemic changes could not only be a result of direct action of lycopene but also a conseqence of its indirect activity via stimulation of production of signaling metabolites
Continuous ingestion of the DC resulted in an increase in the abundance of
These results raised a number of unanswered questions, one of them being whether the observed systemic effects are specific to the lycopene molecule or other carotenoids would have similar properties.
The other question, to which we do not have an answer, is whether lycopene or dark chocolate molecules directly affected growth of the
Whatever the nature of the prebiotic effect of lycopene, this, to the best of our knowledge, is the first report that ingestion of a carotenoid may have this new property. It is also for the first time our study demonstrated that dark chocolate has a similar effect albeit selective for a different putatively beneficial bacteria.
To conclude, the observed systemic effect of lycopene supplementation, or dark chocolate ingestion, which includes improvement of gut, blood, liver lipid metabolism and, for the former, skeletal muscles and skin parameters could be not just due to the carotenoid and dark chocolate properties themselves, but are likely also to modulate the gut microbiome increasing the relative abundance of putatively beneficial bifidobacteria and lactobacilli.
The supporting results will be displayed on the publicly available website Lycotec.com. Moreover, the data that support the findings of this study are available from the corresponding author, Dr. Ivan M Petyaev, upon reasonable request.
The authors declare no conflicts of interest involved.
Maria Wiese, Yuriy Bashmakov and Ivan Petyaev designed research; Natalia Chalyk, and Tatyana Bandaletova conducted clinical work; Dennis Sandris Nielsen, Łukasz Krych, and Witold Kot performed microbiota analysis; Dmitry Pristensky, Marina Chernyshova, and Natalia Chalyk conducted analytic and morphological assays; Maria Wiese and Ivan Petyaev analysed results and wrote the paper; Ivan Petyaev, Maria Wiese, and Yuriy Bashmakov had primary responsibility for final content of the manuscript. All authors read and approved the final manuscript.
We thank Kristina Kaasik for help with gDNA extraction from stool samples and PCR.