We sought to investigate the prevalence of potentially pathogenic bacteria in secretions and tonsillar tissues of children with chronic adenotonsillitis hypertrophy compared to controls. Prospective case-control study comparing patients between 2 and 12 years old who underwent adenotonsillectomy due to chronic adenotonsillar hypertrophy to children without disease. We compared detection of
Chronic tonsillar diseases have great impact in general health worldwide, particularly in children [
Multiple factors are involved in host colonization by microorganisms [
Bacteria such as
In the present study, the presence of genomic DNA of five bacteria commonly detected in respiratory infections was associated with symptoms and signs of chronic adenotonsillar disease.
In this cross-sectional case-control study, the frequency of detection of bacterial genomes was compared between children with chronic adenotonsillar hypertrophy and controls. The study was conducted between May 2010 and August 2012, with children 2–12 years old (mean of 6 years) who were treated at the Otorhinolaryngology Division of the University Hospital, Medical School of Ribeirao Preto, University of São Paulo.
The study group consisted of children who underwent adenotonsillectomy due to chronic adenotonsillar hypertrophy. Before surgery, all children were assessed with a full otorhinolaryngological examination, including flexible nasal endoscopy. Inclusion criteria were the presence of sleep apnea, tonsillar hypertrophy grade ≥3 (both palatine tonsils (PT) occupied 50% or more of the oropharynx width), and the adenoid (AD) occupied 70% or more of the nasopharynx at endoscopy.
The control group consisted of children who underwent cochlear implantation, in the absence of symptoms of adenotonsillar disease or hypertrophy, palatine tonsils graded ≤2 (both PT occupied 50% or less of the oropharynx width), and AD occupied 50% or less of the nasopharynx at endoscopy.
Exclusion criteria for both groups were the presence of symptoms and signs of acute infection of the upper respiratory airways at the time of surgery, antibiotic use 4 weeks prior to surgery, past history of adenotonsillar or sinonasal surgery, genetic syndromes, a history suggestive of primary ciliary dyskinesia, cystic fibrosis, or immunodeficiencies.
During adenotonsillectomy under general anesthesia, three samples were collected from every patient: (a) nasopharyngeal wash (NPW): saline flushed into both nasal cavities and collected at the nasopharynx using a sterile syringe; (b) fragment of adenoid tissue (AD), collected with a conventional Beckman curette for adenoidectomy; and (c) fragment of palatine tonsil (PT) collected with a cold-knife scalpel. From control patients, during surgery for cochlear implant, a mouth-opener was placed and small tissue fragments were obtained with punch biopsy from adenoid and palatine tonsil tissues, apart from NPW.
Tissue samples from PT and AD were placed in Eagle’s minimal essential medium (MEM) supplemented with 10% fetal bovine serum and 15% antibiotic-antimycotic solution (penicillin-streptomycin 20,000 U/ml and amphotericin B 200 mg/mL, both from Gibco (Grand Island, NY, USA)) and transported on ice within a maximum of 4 hours for further processing in the laboratory. Tissue samples were washed twice with MEM to remove debris and blood clots, and then minced in TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) for subsequent extraction of total nucleic acids. NPW samples were distributed in several aliquots, including one of 250
The bacterial genome was detected by real-time PCR using TaqMan probes (Applied Biosystems®, Foster City, CA, USA) after DNA extraction with TRIzol®. Primers and probes were designed to detect
Primers and probes used for bacterial detection.
Bacteria | Primers | Probes | References |
---|---|---|---|
|
5′TGCAGAGCGTCCTTTGGTCTAT3′ (FORWARD) | FAM 5′TGGCGCCCATAAGCAACACTCGAA-Tamra 3′ TAMRA | Corless et al., [ |
5′CTCTTACTCGTGGTTTCCAACTTGA3′ (REVERSE) | |||
|
5′GTTGCTTAGTGTTAACTTTAGTTGTA 3′ (FORWARD) | 5′-VIC-AAGTCTAAGTAGCTCAGCAAATGCA-MGB-3′ | Kilic et al., [ |
5′AATGTCGCAGGTTCTTTATGTAATTT 3′ (REVERSE) | |||
|
5′CGAGTACAACATGGCTCTGG 3′ (FORWARD) | 5′-FAM-CCTGCAGCACCAGGTAGCGC-Tamra-3′ | Feizabadi et al., [ |
5′ACCGGACGCTCTTTACCATA 3′ (REVERSE) | |||
|
5′CCAGCTGCTAAAGTATTAGTAGAAG 3′ (FORWARD) | 5′-VIC-CAGATGCAGTTGAAGGTTATTTAG-MGB-3′ | Abdeldaim et al., [ |
5′TTCACCGTAAGATACTGTGCC 3′ (REVERSE) | |||
|
5′GTCAAACAGCTGGAGGTATTGC 3′ (FORWARD) | 5′-NED-ATCGCAATTGCAACTTT-MGB-3′ | Heiniger et al., [ |
5′GACATGATGCTCACCTGCTCTA 3′ (REVERSE) |
Comparisons between groups were made by Fisher’s exact test, and agreement among the three specimens (AD, PT, and NPW) was assessed by kappa coefficients. In all analyses,
All legal guardians signed informed consent forms. The study was performed in accordance with the Declaration of Helsinki and approved by the Ethics Committee of the University Hospital, Medical School of Ribeirão Preto, file number 10466/2008.
A total of 51 children were enrolled: 37 in the tonsillectomy group and 14 in the cochlear implant control group. In both groups, children ages were 2 to 12 years, with mean ages of 6 years and 4.1 years, respectively, in the tonsillectomy and control groups.
The overall rates of bacterial detection in all sampling sites (PT, AD, and NPW) were similar between patients with chronic adenotonsillitis and controls (Table
Detection rates of bacteria in tonsillar tissues and nasopharyngeal washes from patients with adenotonsillar hypertrophy and controls.
Bacteria | Palatine tonsils | Adenoids | NPW | Total | ||||
---|---|---|---|---|---|---|---|---|
Controls |
ATH |
Controls |
ATH |
Controls |
ATH |
Controls |
ATH |
|
|
0 (0) | 3 (8.1) | 2 (14.2) | 1 (2.7) | 0 (0) | 4 (10.8) | 2 (14.2) | 6 (16.2) |
|
4 (28.6) | 19(51.3) | 9 (64.2) | 21(56.7) | 11 (78.5) | 26 (70.2) | 12 (85.7) | 29 (78.3) |
|
8 (57.1) | 24(64.8) | 9 (64.2) | 16(43.2) | 10 (71.4) | 26(70.2) | 12 (85.7) | 30 (81) |
|
4 (28.6) | 6 (16.2) | 2 (14.2) | 8 (21.6) | 2 (14.2) | 9 (24.3) | 6 (42.8) | 17 (45.9) |
|
3 (21.4) | 6 (16.2) | 4 (28.5) | 15(40.5) | 7 (50) | 20 (54) | 7 (50) | 21 (56.7) |
NPW: nasopharyngeal washes; ATH: adenotonsillar hypertrophy.
To assess the agreement in bacteria rates between the different sample sites, kappa test was used (Table
Analyses of agreement of bacteria detection rates among different specimens collected from patients with chronic adenotonsillitis, severe adenotonsillar hypertrophy, and controls.
Bacteria | Specimens | Patients | Kappa coefficient | 95% CI |
---|---|---|---|---|
|
Adenoid × palatine tonsil | Control | 0 | (−1.04; 1.04) |
Chronic adenotonsillitis | −0.0435 | (−0.1098; 0.0228) | ||
Severe adenotonsillar hypertrophy | −0.0769 | (−0.1958; 0.0419) | ||
Palatine tonsil × nasopharyngeal wash | Control | 0 | (−1.04; 1.04) | |
Chronic adenotonsillitis | −0.0465 | (−0.1218; 0.0287) | ||
Severe adenotonsillar hypertrophy | −0.0769 | (−0.1958; 0.0419) | ||
Adenoid × nasopharyngeal wash | Control | 0 | (−1.04; 1.04) | |
Chronic adenotonsillitis | 0.5277 | (0.0599; 0.9954) | ||
Severe adenotonsillar hypertrophy | 0.614 | (0.1266; 1.0000) | ||
Adenoid × palatine tonsil | Control | −0.1455 | (−0.5712; 0.2802) | |
Chronic adenotonsillitis | 0.132 | (−0.1858; 0.4497) | ||
Severe adenotonsillar hypertrophy | 0.0833 | (−0.3336; 0.5003) | ||
Palatine tonsil × nasopharyngeal wash | Control | 0.3171 | (−0.1899; 0.8241) | |
|
Chronic adenotonsillitis | 0.5325 | (0.2658; 0.7991) | |
Severe adenotonsillar hypertrophy | 0.5299 | (0.1836; 0.8763) | ||
Adenoid × nasopharyngeal wash | Control | 0.1967 | (−0.0539; 0.4473) | |
Chronic adenotonsilliti | 0.4873 | (0.2219; 0.7528) | ||
Severe adenotonsillar hypertrophy | 0.5299 | (0.1836; 0.8763) | ||
Adenoid × palatine tonsil | Control | 0.6829 | (0.2996; 1.0000) | |
Chronic adenotonsillitis | 0.2725 | (−0.0046; 0.5495) | ||
Severe adenotonsillar hypertrophy | 0.3937 | (0.0567; 0.7307) | ||
Palatine tonsil × nasopharyngeal wash | Control | 0.4179 | (−0.1244; 0.9602) | |
|
Chronic adenotonsillitis | 0.2825 | (0.0243; 0.5408) | |
Severe adenotonsillar hypertrophy | 0.1538 | (−0.1936; 0.5013) | ||
Adenoid × nasopharyngeal wash | Control | 0.087 | (−0.4156; 0.5895) | |
Chronic adenotonsillitis | 0.3854 | (0.0724; 0.6984) | ||
Severe adenotonsillar hypertrophy | 0.5217 | (0.1575; 0.8859) | ||
Adenoid × palatine tonsil | Control | −0.2353 | (−0.4760; 0.0054) | |
Chronic adenotonsillitis | 0.2986 | (−0.0725; 0.6696) | ||
Severe adenotonsillar hypertrophy | 0.2281 | (−0.3034; 0.7646) | ||
Palatine tonsil × nasopharyngeal wash | Control | −0.1667 | (−0.3277; −0.0056) | |
|
Chronic adenotonsillitis | 0.0082 | (−0.3152; 0.3317) | |
Severe adenotonsillar hypertrophy | 0.0494 | (−0.3519; 0.4507) | ||
Adenoid × nasopharyngeal wash | Control | 0.1765 | (−0.3573; 0.7103) | |
Chronic adenotonsillitis | −0.0761 | (−0.3555; 0.2034) | ||
Severe adenotonsillar hypertrophy | −0.2222 | (−0.4076; −0.0369) | ||
Adenoid × palatine tonsil | Control | 0.4324 | (−0.1001; 0.9649) | |
Chronic adenotonsillitis | 0.3183 | (0.0437; 0.5928) | ||
Severe adenotonsillar hypertrophy | 0.4086 | (−0.0008; 0.8180) | ||
Palatine tonsil × nasopharyngeal wash | Control | 0.5714 | (0.1830; 0.9598) | |
|
Chronic adenotonsillitis | 0.6273 | (0.3876; 0.8671) | |
Severe adenotonsillar hypertrophy | 0.7179 | (0.4334; 1.0000) | ||
Adenoid × nasopharyngeal wash | Control | 0.4286 | (0.0402; 0.8170) | |
Chronic adenotonsillitis | 0.2825 | (0.0761; 0.4890) | ||
Severe adenotonsillar hypertrophy | 0.4211 | (0.0989; 0.7432) |
In the control group, the correlation between AD and PT was good for
In the group of patients with chronic adenotonsillitis, kappa analyses revealed no correlation between bacteria rates in PT and AD (Table
To further probe into differences in the magnitudes of bacterial colonization of different sites, quantitative values of bacterial loads were compared among those sites for both groups of patients (Table
Descriptive statistics for bacterial loads by group and tissue.
Tissue | Bacteria | Mean | Standard deviation | Minimum | 1° Quartile | Median | 3° Quartile | Maximum |
---|---|---|---|---|---|---|---|---|
|
||||||||
Adenoid |
|
16.64 | 0.56 | 15.89 | 16.28 | 16.7 | 16.99 | 17.25 |
|
17.82 | 1.9 | 13.31 | 16.87 | 17.84 | 19.15 | 21.28 | |
|
10.65 | 2.31 | 5.95 | 9.34 | 10.86 | 12.44 | 14.33 | |
|
8.95 | 1.12 | 7.01 | 8.54 | 9.05 | 9.99 | 10.05 | |
|
11.59 | 0.95 | 10.88 | 11.02 | 11.16 | 11.95 | 13.36 | |
|
17.58 | 17.58 | 17.58 | 17.58 | 17.58 | 17.58 | ||
|
18.13 | 1.95 | 12.61 | 16.95 | 18.47 | 19.11 | 21.31 | |
|
10.41 | 1.59 | 7.29 | 9.04 | 10.47 | 11.53 | 13.36 | |
|
7.7 | 0.6 | 6.66 | 7.2 | 7.9 | 8.23 | 8.24 | |
Palatine tonsil |
|
13.05 | 1.68 | 10.67 | 11.26 | 13.38 | 14.05 | 16.6 |
|
14.87 | 0.51 | 14.11 | 14.57 | 15.09 | 15.17 | 15.18 | |
|
17.62 | 6 | 6.49 | 14.14 | 17.44 | 19.59 | 39.47 | |
|
10.31 | 2.37 | 3.91 | 8.76 | 10.47 | 11.83 | 14.21 | |
|
4.77 | 1.37 | 1.24 | 4.92 | 5 | 5.19 | 5.85 | |
Nasopharyngeal washes |
|
12.97 | 3.36 | 7.38 | 9.77 | 13.53 | 15.36 | 18.85 |
|
|
|
|
|
|
|
| |
|
21.99 | 4.57 | 19.48 | 19.55 | 19.82 | 24.43 | 28.84 | |
|
11.33 | 2.22 | 8.06 | 9.76 | 11.31 | 12.67 | 15.07 | |
|
8.62 | 1.33 | 6.82 | 7.72 | 8.81 | 9.51 | 10.02 | |
Adenoid |
|
14.91 | 1.07 | 13.74 | 13.74 | 15.18 | 15.82 | 15.82 |
|
17.51 | 0.52 | 17.14 | 17.14 | 17.51 | 17.87 | 17.87 | |
|
20.83 | 5.22 | 15.07 | 16.78 | 20.86 | 22.36 | 31.61 | |
|
11.3 | 2.43 | 9.01 | 9.71 | 10.63 | 12.15 | 16.8 | |
|
7.05 | 3.09 | 4.86 | 4.86 | 7.05 | 9.23 | 9.23 | |
Palatine tonsil |
|
13.88 | 1.88 | 12.43 | 12.62 | 13.24 | 15.13 | 16.59 |
|
|
|
|
|
|
|
| |
|
18.04 | 3.74 | 12.81 | 14.71 | 18.1 | 20.54 | 24.63 | |
|
9.8 | 2.82 | 4.02 | 9.01 | 9.82 | 11.22 | 13.9 | |
|
4.89 | 0.3 | 4.67 | 4.67 | 4.89 | 5.1 | 5.1 | |
|
||||||||
Nasopharyngeal washes |
|
14.28 | 5.21 | 8.09 | 10.36 | 11.51 | 19.38 | 21.31 |
Bacteria detection rates in different sampling sites were finally compared only among the 22 (59.4%) patients who had severe tonsillar hypertrophy (Brodsky index ≥3).
Bacterial detection in tonsils of patients with higher hypertrophy. The graph shows the frequency of bacterial detection in tonsils (a) and in adenoids (b). The graph shows the patients who presented bacterial codetection in the (c) tonsils and in adenoids (d).
The frequencies of bacteria codetections were especially high in patients with more severe tonsillar hypertrophy (Figures
Kappa analyses were also performed considering only patients with severe tonsillar hypertrophy (Table
Chronic tonsillitis is characterized by chronic or recurrent infections of the tonsils and adenoids that can lead to tissue enlargement. Tonsillar hypertrophy is one of the most common diseases found in children and its etiology is still obscure. Its treatment is based on the administration of antibiotics and adeno/tonsillectomy, which is one of the most common surgical procedures performed worldwide. Many studies have reported that adeno/tonsillectomy leads to a reduction in the number of episodes of throat pain in children in the first year after surgery compared to nonsurgical treatment [
Many studies have shown that the tonsils of patients with recurrent tonsillitis are colonized by a large number of bacteria, both pathogenic and nonpathogenic, showing that these agents possibly may play a role in the development of chronic tonsillar disease [
There is evidence that large numbers of bacteria make up surface biofilms of the adenoids [
Pathogenic bacteria such as
In the present study, detection and loading frequencies of genomic DNA were determined by real-time PCR for five of the most common bacteria of the nasopharyngeal microbiota, namely:
Regardless of the state of tonsillar hypertrophy, the highest detection rates of
The lack of uniform association of specific bacteria with tonsil hypertrophy is not surprising and suggests that the role of these bacteria in the development of tonsillar hypertrophy is far from clear and probably not due to a direct effect.
The sampling sites and methods used for bacterial detection are critical in this type of study. Pathogenic and anaerobic bacteria are easily detected in the nuclei of the tonsils, while commensal aerobic bacteria are found on the surface of these tissues [
In the present study, different types of clinical samples were tested for five potentially pathogenic bacteria by a sensitive molecular assay, the real-time PCR assay. Nasopharyngeal lavages allowed the detection of planktonic bacteria, while fragments of tonsillar tissue provided direct association with sessile biofilms. No differences were observed in bacterial frequency or bacterial loads between control children and patients with adenotonsillar hypertrophy. We should emphasize that bacterial detection was widely different between adenoids and palatine tonsils in all patient groups. This suggests that there may be tissue-specific colonization by these bacteria in different tonsils, rather than a homogenous distribution of planktonic biofilm microorganisms in all tissues.
Several studies indicate that
In the present study, kappa analysis compared the detection of a bacterium at different sampling sites of different patient groups to assess whether extensive infection by certain bacteria could be associated with amygdala hypertrophy. In the control group, represented by the children as ATH group, despite the difference of slits in the middle ages, a good correlation was found between the detection of
The rates of detection of
The role of colonizing bacteria in the development of tonsillar hypertrophy is currently unknown. In our study, we evaluated a single facet of a complex interaction between the microbiota and the host. The influence of other factors, including the individual characteristics of each patient’s immune system, coinfection, and other nonmicrobial agents, could eventually interfere with the results [
In summary, in the present study, a high proportion of children with chronic tonsillar inflammation and hypertrophy had detectable potentially pathogenic bacteria in tonsillar tissues, as well as in the control patients. Importantly, in patients with more severe tonsillar hypertrophy, there was good agreement between sites for detection of
The data used to support the findings of this study are included within the article.
The authors declare that they have no conflicts of interest.
The authors thank Maria Cecília Onofre for secretarial assistance. This study was supported by São Paulo Research Foundation–FAPESP, CAPES, and CNPq.