Intravenous immunoglobulin (IVIG) is used in the treatment of neuropathy. This case report presents, for the first time, a patient with severe periodontal destruction after chronic therapy with IVIG. The patient reported having extracted his maxillary anterior teeth himself due to high mobility. Clinical examination and radiographic images show a generalized and severe periodontitis. No significant alterations in genetic or microbiological features were observed. The present case suggests that periodontal disease aggravation could be considered a new adverse effect of IVIG therapy. Postulated mechanisms are immune complexes formation, complement activation, and a direct effect in osteoclasts. In conclusion, it is important that patients that will receive IVIG treatment underwent dental evaluation.
Multifocal motor neuropathy (MMN) with conduction block is an acquired immune-mediated demyelinating neuropathy with slowly progressive weakness, without significant sensory involvement [
IVIG is a preparation of highly purified immunoglobulin, predominantly composed by IgG subclasses [
Periodontitis (PD) is a chronic infectious disease characterized by plaque-induced destruction of soft and hard periodontal tissues [
This report presents, for the first time, a possible new adverse effect of IVIG treatment, with a patient in chronic use of this medication showing severe and generalized periodontal destruction.
A 36-year-old man presented with tooth mobility at Serviço Especial de Diagnóstico e Tratamento em Odontologia (SEDTO) at Hospital das Clínicas, Universidade Federal de Minas Gerais (HC-UFMG). Patient was referred from the Serviço de Neurologia. In 2013, he reported extracting himself his maxillary anterior teeth due to high mobility of those teeth. According to the patient, this dental alteration began after the start of medical treatment with IVIG.
From 2007 patient developed progressive muscle weakness, with difficulties to walk and climb stairs. Clinical examination showed weakness on all four members with hiporreflexia but no changes on sensory function and cranial nerves. An extensive laboratory work-up was performed, including rheumatologic screening (e.g., antinuclear antibodies (ANA), rheumatoid factor, erythrocyte sedimentation speed, and reactive protein C), without any significant finding. Electroneuromyography showed an asymmetric multifocal blocking of axonal and myelinic motor conduction. The patient was then diagnosed with “multifocal motor neuropathy with conduction blocks” and started, in 2007, monthly to use intravenous immunoglobulin (2 mg/kg during five days a month). The evolution of the clinical status (improvement on muscle strength) was considered excellent. During 2009 there was a modification in the therapeutic scheme, with the beginning of monthly cyclophosphamide pulse therapy (1 g/cycle; 10 cycles); however, the patient responded with worse clinical features, which suggested “dependence” of immunoglobulin to control the symptoms, and then the IVIG treatment was restarted.
Recently, the patient has a stable motor status with monthly immunoglobulin scheme.
In April 2013 the patient was sent to dental evaluation after complain of an accentuated dental mobility after the start of therapy with immunoglobulin. Before that, patient did not notice any bleeding or modifications in gingiva. During the anamnesis, the patient reported previous smoking habit, but he stopped since 2007. Upon clinical examination the patient showed dental mobility in several elements, accumulation of gross calculus, and tooth pigmentation (Figure
Clinical features of the severe periodontal disease at first consultation. Anterior teeth lost and accumulation of gross calculus and tooth pigmentation.
Radiographic features of severe periodontal disease. Generalized vertical and horizontal bone loss.
Patient underwent complete periodontal examination, in which bleeding on probing (BOP) in 52% of sites was observed, probing depth (PD) > 4 mm in 37% of all dental sites (Table
Clinical features before and after the periodontal therapy.
Periodontal therapy | ||
---|---|---|
Before | After | |
PD (mm) | 4.10 | 2.31 |
CAL (mm) | 4.44 | 2.60 |
BOP (%) | 51.78 | 24.0 |
PD: probing depth; CAL: clinical attachment loss; BOP: bleeding on probing.
To better explore mechanisms that could explain the severe periodontal status, subgingival dental plaque samples were collected by sterile endodontic paper points ISO number 40 (Tanariman LTDA, Manacaparu, AM, Brazil). The paper points were inserted in the 5 sites with deepest periodontal pockets and kept there for one minute. Subgingival samples were used for qPCR assays for microorganism detection. Bacterial or viruses DNA was extracted as previously described [
Primer sequences from the genetic and microbiological analysis.
Target | Sense/antisense sequences |
---|---|
|
ATGCCAACTTGACGTTAAAT |
AAACCCATCTCTGAGTTCTTCT | |
|
|
|
TACCCATCGTCGCCTTGGT |
CGGACTAAAACCGCATACACTT | |
|
|
|
GCGGAACTACAAGTGTAGAGGT |
GTTCGACCCCCAACACCTAGTA | |
|
|
|
AGAGCAAGCTCTCCCTTACCGT |
TAAGGGCGGCTTGAAATAATGA | |
|
|
|
AGAGCAAGCTCTCCCTTACCGT |
TAAGGGCGGCTTGAAATAATGA | |
|
|
EBV-1 | CCTGGTCATCCTTTGCCA |
TGCTTCGTTATAGCCGTAGT | |
|
|
HSV-1 | CGGCCGTGTGACACTATCG |
CTCGTAAAATGGCCCCTCC | |
|
|
HCMV | TGAGCCCGGCGGTGGT |
AGCTCACCGATCACAGACAC | |
|
|
IL1B-3954 SNP | CTCAGGTGTCCTCGAAGAAATC |
GCTTTTTTGCTGTGAGTCCCG | |
|
|
TNFA-308 SNP | AGGCAATAGGTTTTGAGGGCCA |
TCCTCCCTGCTCCGATTCCG | |
|
|
IL6-174 SNP | TTGTCAAGACATGCCAAGTGCT |
GCCTCAGAGACATCTCCAGTCC | |
|
|
IL10-592 SNP | GGTCTCTGGGCCTTAGTTTCC |
AACTTTAGACTCCAGCCACAGA | |
|
|
TGFB1-509 SNP | TTTTGCCATGTGCCCAGTAG |
CACCAGAGAAAGAGGACCAG | |
|
|
MMP1-1607 SNP | TCGTGAGAATGTCTTCCCATT |
TCTTGGATTGATTTGAGATAAGT |
In order to verify whether the bad periodontal condition was linked to a susceptible background, the patient was typed for HLA molecules [
The patient was submitted to periodontal therapy which included sessions of supra and subgingival scaling and root planning to control local factors that could worsen periodontal disease. Moreover, extraction of left maxillary first and third molar and left mandibular second molar was done. The patient was forwarded to prosthetic rehabilitation. At present, the patient is stable, in follow-up in the SEDTO at HC-UFMG for periodic periodontal monitoring.
The last periodontal examination, in January 2014, showed that PD was reduced in most of the sites and the BOP was strongly reduced (Table
Clinical features after periodontal therapy. Good hygiene without calculus or plaque.
Currently, bidirectional associations of PD with systemic diseases have been reported [
Despite we have no dental record before IVIG treatment, both medical evaluation and patients’ perception consistently reported that oral condition became worse after the beginning of therapy. Therefore, the hypothesis is that the use of immunoglobulin exacerbates the preexistent periodontal condition, remaining undefined if patient had or not alveolar bone loss before using IVIG. This report describes, for the first time, a possible adverse reaction after IVIG treatment. It is necessary to better understand the mechanisms of this association.
Intravenous immunoglobulin is a preparation of highly purified immunoglobulin collected from a large pool of healthy human plasma. Human IVIG contains biologic active IgG and trace amounts of IgA, IgM, CD4, CD8, and human leukocyte antigen molecules [
In view of the IVIG mechanism of action it was expected that IVIG treatment might decrease the inflammation in periodontal sites, consequently, diminishing bone and attachment loss. However, in the case reported, we observe a worse of periodontal condition. A possible explanation is the formation of immune complexes, with IgG aggregates, that could lead to activation of complement cascade [
Another mechanism related to adverse reactions in IVIG therapy is the formation of oligomeric or polymeric IgG complexes that interact with Fc receptors and trigger the release of inflammatory mediators [
In general, adverse reactions to IVIG therapy are usually minor and occur in no more than 10% of the patients [
The authors declare that there is no conflict of interests regarding to the publication of this paper.
Sources of support are FAPEMIG, CNPq, and CAPES.