6,12-Diphenyl-3,9-diazatetraasterane-1, 5, 7, 11-tetracarboxylate (DDTC) has been synthesized by the photodimerization of 4-phenyl-1,4-dihydropyridine-3,5-dicarboxylate. The potential of theercvantitumor activity and mechanism were investigated
The structure of 6,12-diaryl-3,9-diazatetraasterane-1,5,7,11-tetracarboxylates (Figure
The structure of DDTC.
Fetal bovine serum (FBS) was obtained from HyClone (USA), and RPMI (Roswell Park Memorial Institute) 1640 medium, DMEM (Dulbecco’s Modified Eagle Medium), penicillin, streptomycin, and all other reagents were obtained from Gibco (USA). DDTC, synthesized by the College of Chemical Engineering, Shijiazhuang University, was dissolved in DMSO and the final concentration of DMSO in cultures was ≤0.1%(
The human lung cancer cell line A549, human breast cancer cell line MCF-7, human gastric cancer cell line BGC-823, ovarian cancer cell lines SKOV3 and A2780, human liver cancer cell line SMMC-7721, colon cancer HT29 cells, and prostate cancer DU145 cells were cultured in RPMI1640 medium with 10% (
Briefly, human lung cancer A549 cells, ovarian cancer SKOV3 and A2780 cells, breast cancer MCF-7 cells, gastric cancer BGC-823 cells, colon cancer HT29 cells, prostate cancer DU145 cells, and liver cancer SMMC7721 cells were seeded into 96-well plates for 24, 48, and 72 hours at 37°C, respectively. An antiproliferation assay was performed by the MTT method. [
SKOV3 and A2780 cells were cultured in RPMI1640 medium with 2% serum accompanied with 0.1, 1, and 10
SKOV3 and A2780 cells were exposed to 0.1, 1, and 10
SKOV3 and A2780 cells were treated with DDTC at 0.1, 1, and 10
According to the manufacturer’s instruction (Nippon Gene Co. Ltd., Tokyo, Japan), the total RNA was procured from the SKOV3 and A2780 cells, which were treated with DDTC for 48 hours. After spectrophotometric quantification at 260 nm, total RNA (1 mg) was converted into cDNA by Reverse Aid First-Strand cDNA Synthesis kit (Thermal Scientific Co. Ltd., USA). Using the reaction mixtures (20
The sequences of 8 pairs of primers.
Primers | Forward (5 | Reverse (5 |
---|---|---|
Chk1 | CTCCTCAGCATCTTATCCGAGT | GCTGTTCCGTCCCAGTAGATTA |
Cdc25a | CTGGATAATGGTGAATGGACAC | CGATGTGGCATACTTGTTCTTG |
CDK1 | CTGGACACTGAGAGGGCAATC | AAATGGGAAGGAGAAGGAGAAG |
Caspase 3 | ATGGAGAACAATAAAACCT | CTAGTGATAAAAGTAGAGTTC |
Cleaved caspase3 | CCATAAAAGCACTGGAATGTCA | CCGTTCGTTCCAAAAATTACTC |
Caspase 9 | GGCTGTCTACGGCACAGATGGA | CTGGCTCGGGGTTACTGCCAG |
Cleaved caspase9 | AAACTGTCCAGCACTTTCA | GGTCCCGTAAAGCAACAT |
Vimentin | TGCCGTTGAAGCTGCTAACTA | CCAGAGGGAGTGAATCCAGATTA |
N-cadherin | TTTGATGGAGGTCTCCTAACACC | ACGTTTAACACGTTGGAAATGTG |
E-cadherin | AAAGGCCCATTTCCTAAAAACCT | TGCGTTCTCTATCCAGAGGCT |
TGACGTGGACATCCGCAAAG | CTGGAAGGTGGACAGCGAGG |
The antiproliferative activity of DDTC was assessed in human lung cancer cells A549, ovarian cancer cells SKOV3 and A2780, breast cancer cells MCF-7, gastric cancer cells BGC-823, colon cancer cells HT29, prostate cancer cells DU145, and liver cancer cells SMMC7721
IC50 of DDTC on different cancer cell lines.
TTime (hour) | IC50 ( | |||||||
---|---|---|---|---|---|---|---|---|
A549 | SKOV3 | A2780 | MCF-7 | BGC-823 | HT29 | DU145 | SMMC7721 | |
24 | >100 | >100 | >100 | >100 | >100 | |||
48 | >100 | >100 | >100 | >100 | ||||
72 | >100 | >100 | >100 | >100 |
The wound healing and Transwell assay were performed to explore the DDTC mechanistic study in ovarian cancer cell lines. The significant different results were showed that the compound of DDTC inhibited migration in ovarian cancer SKOV3 and A2780 cells, respectively (Figure
The effect of DDTC on the invasion and migration in ovarian cancer cells. The dosage of DDTC at 0.1
EMT is a key factor of epithelial carcinoma dissemination which includes cancer migration, invasion, and transport through the blood/lymph vessels in tumors. [
The effect of DDTC on the EMT in ovarian cancer cells. The dosage of DDTC at 0.1
The proliferation of cells is closely related to the cell cycle. The results of the MTT assay provided the first evidence of the antiproliferative effect of DDTC, so we used flow cytometric analysis to evaluate whether DDTC induces the cell cycle arrest. According to the results of flow cytometric analysis, DDTC increased the cell population at the G2 phase in SKOV3 and A2780 cells (Figure
Analysis of cell cycle progression by flow cytometry. The dosage of DDTC at 0.1
Chk1, Cdc25a, and CDK1 were proved to be linked to cell cycle arrest, which could regulate cell proliferation. CDKs control cell progression by binding with cyclins. Cyclin B1 induces cell cycle G2 to the M phase by activation of CDK1. Cdc25a is an important regulator in cell proliferation. Chk1 leads to DNA damage by inhibiting Cdc25a activity [
The effect of DDTC on expression of cell cycle regulators. The dosage of DDTC at 0.1
Apoptosis is a genetically regulated process of cell suicide, which is modulated by a variety of cellular signaling pathways. The central component of the apoptotic machinery is a proteolytic system consisting of caspases [
The effect of DDTC on the expression of caspase 3, cleaved caspase 3, caspase 9, and cleaved caspase 9. The dosage of DDTC at 0.1
In this study, we have provided evidence of the antitumor effect of DDTC. Firstly, we selected several human cancer cells lines including lung cancer cell line A549, ovarian cancer cell lines SKOV-3 and A2780, breast cancer cell line MCF-7, gastric cancer cell line BGC-823, colon cancer cell line HT29, prostate cancer cell lines DU145, and liver cancer cell line SMMC-7721 to confirm whether DDTC could inhibit the growth of cancer cells. According to the results of the MTT assay, the inhibitory effect of DDTC on the proliferation of ovarian cancer was more effective than that on the other cancers mentioned above.
Therefore, we study the anticancer mechanism of DDTC further.
The migration of cancer cells is closely related to the proliferation of cells, so we used the wound healing and Transwell assay to detect the effect of DDTC on the migration and invasion. These confirmed that DDTC inhibited migration were consistent with increasing the protein expression levels of E-cadherin and decreasing the protein and mRNA expression levels of EMT markers (N-cadherin and Vimentin) in ovarian cancer cells.
MTT assay result provided the first evidence of the antiproliferative effect of DDTC. Flow cytometric analysis showed that DDTC induced cell cycle arrest at the G2 phase in A2780 and SKOV3 cells. CDK1 is a key regulator of the cell cycle at this checkpoint. The activation of CDK1 is critical to the cell cycle of the transition from the G2 to M phase. [
Checkpoints induce cell cycle arrest, which closely links to cell DNA damage and apoptosis. Apoptosis was proved regulated by many cellular pathways and decrease the activities of caspase 3 and caspase 9, which was related to the tumor development [
In summary, DDTC could inhibit the growth of human cancer cells and display remarkable antitumorigenic activities, which included the effect of DDTC on the cell cycle checkpoints, migration and invasion in ovarian cancer cells. The DDTC exhibited an ability to increase the expression of cleaved caspase 9 and cleaved caspase 3 proteins and reduced the expression of caspase 9 and caspase 3 proteins in SKOV3 and A2780 cells, which indicated that DDTC induced apoptosis by the caspase-dependent pathway. All these results illustrated that DDTC could be a potential drug candidate to treat ovarian cancer.
The data are available upon direct request to the corresponding author.
The authors declare that they have no competing interests.
Pingping Chen and Huibing Wang contributed equally to the work.
This work was supported by funding from the Key Basic Applied Project of Hebei Provincial Department of Science &Technology (15967730D) awarded to Wei Zhang.