Vertebrate sympathetic neurons have the remarkable potential to switch their neurotransmitter phenotype from noradrenergic to cholinergic—a phenomenon that has been intensively studied in rat and chicken models. In both species, loss of noradrenergic markers and concomitant upregulation of cholinergic markers occurs in response to neuropoietic cytokines such as ciliary neurotrophic factor (CNTF). However, other aspects of the neurotransmitter switch including developmental timing, target tissues of cholinergic neurons, and dependence on neurotrophic factors differ between the two species. Here we compare CNTF-triggered transcriptome changes in both species by using DNA microarrays. CNTF induced changes in 1130 out of 16084 analyzed genomic loci in rat sympathetic neurons. When this set of genes was compared to CNTF-induced changes in the chicken transcriptome, a surprisingly small overlap was found—only 94 genes were regulated in the same direction in chicken and rat. The differential responses of the transcriptome to neuropoietic cytokines provide additional evidence that the cholinergic switch, although conserved during vertebrate evolution, is a heterogeneous phenomenon and may result from differential cellular mechanisms.
Transmitter phenotypes are specified at defined stages during neuronal development through coordinated expression of complex sets of gene products, involved in the synthesis and transport of transmitters [
While progress has been made in the mechanistic understanding of how neuropoietic cytokines trigger cholinergic transdifferentiation
In the current study, we employed DNA microarrays to analyze the transcriptome changes that occur in rat sympathetic neurons cultured for 7 days in the presence of CNTF, a treatment which triggers cholinergic differentiation through the p38 MAPK/Satb2 signalling module. A comparison of the resulting dataset with the effect of procholinergic treatments on the chicken transcriptome revealed surprisingly large differences. A small set of genes was identified as coregulated with neurotransmitter markers in both species under all experimental conditions and thus represents the evolutionary conserved neurotransmitter synexpression group of sympathetic neurons. The newly identified marker genes provide a resource for future functional analysis and stratification of neurotransmitter phenotypes of the sympathetic nervous system.
Primary cell culture was prepared as follows. Sympathetic neurons from superior cervical ganglia (SCG) of newborn rats (P0-P2) were dissociated and plated at a density of 100 000 cells per well onto 6-well plates previously coated with poly-L-ornithine (Sigma) and laminin (Sigma). Cells were grown for 7 days in Ham’s F-14 medium (Invitrogen) supplemented with N2 (Invitrogen) in the presence of either recombinant human NGF (20 ng/mL) alone or CNTF (25 ng/mL, Peprotech) and NGF (5 ng/mL). Cultures were maintained at 37°C in a 3% CO2 atmosphere and were fed every second day. The proliferation of nonneuronal cells was suppressed by treatment with 15 mM aphidicolin (Sigma) starting from day 2 of the culture.
Total RNA was extracted by using TRIzol Reagent (Invitrogen) and cleaned up with RNeasy MinElute Kit (QIAGEN). The quality and size distribution of extracted RNA were evaluated by RNA Nano Kit on the Agilent’s Bioanalyzer.
Microarray experiments and analysis of gene expression data were performed as follows. Affymetrix Rat Genome 230 2.0 and Chicken Genome Arrays were used for genome-wide expression profiling experiments. RNA samples extracted from three independent cell cultures were used for each experimental group. Sample labelling, hybridization, and scanning were carried out at the Expression Profiling Unit (Innsbruck Medical University) according to the Affymetrix standard protocols. Normalization and computation of expression values were performed by using GC-RMA method included in
Quantitative RT-PCR (qRT-PCR) was used as follows.One microgram of total RNA from each sample was reverse transcribed in the presence of oligo-dT primer in a total volume of 20
Gene Symbol | Forward Sequence | Reverse Sequence |
---|---|---|
|
GATTGAGTACCAGAGGAGCC | ATGGCATACTTCTTCTTCTCCTGG |
|
ACAGATTTCGGGACATACCAAAC | ATTCAGACACTTCTCCCACTCC |
|
AAACCATAAGGACGCGGACTT | AGGCTCCAAAGGCACTTGACT |
|
AAGGTGGCCTTCTCCGCTAC | GCTACAAATATACTCGAGGCAAG |
|
CTGGAGAAACCTGCCAAGTATG | ACAACCTGGTCCTCAGTGTAG |
|
TCTCAGCAAAGTCTGGGTTACC | TCCATGACCCTGCTCTCTCTC |
|
CGAACAGACAAGATCTTCAGGC | GTGTTTCTCACAACTGTCCAAAAG |
|
TACCTGAGGCTGTTTGGTGTG | CGAAGCAGTCCAGGTGGTAC |
|
GCTTCTAAACCGAATGGACAGAG | GGGAACTGGATTTGTAATGCCTTG |
|
AGATGCAGCACCTGAAGAGAATG | TTCTGCAGCTGCTTCTGCTC |
|
CAGGCTGAAACCCAAGAAAGTAG | TGACTTCCTTTTCCGTGGTCTG |
|
ACGAACTATGCTAGCGACCTAAG | CTGGCACAATGCACAGTCTTC |
Tissue preparation and immunohistochemistry were as follows. Stellate ganglia from E18 rat embryos and P40 rats were dissected and fixed in 4% paraformaldehyde in PBS for 15 min. The ganglia were cryoprotected by immersion in 25% sucrose solution in PBS at 4°C and mounted in TissueTek medium (Sakura Finetek). Fourteen-micrometer cryostat sections were mounted on gelatine-coated slides and air dried for 1 h at 37°C. The sections were fixed for 5 min in precooled acetone, washed 2 × 5 min each in TBS, and permeabilized for 10 min in 0.25% Triton-X-100 in TBS (TBST). After blocking in 10% normal serum, 1% BSA in TBST, sections were incubated with primary antibodies, rabbit anti-Vacht (1 : 2000, Sigma); mouse anti-ALK (1 : 500; a generous gift from Marc Vigny); and rabbit anti-CGRP (1 : 300; AbD Serotec) diluted in blocking solution at 4°C overnight. Subsequently, sections were rinsed in TBST and incubated in Alexa-Flour-conjugated secondary antibodies (Invitrogen) for 1 h at room temperature. Finally, the sections were incubated for 2 min with 300 nM DAPI in PBS, rinsed again in TBS and distilled water, and mounted with Mowiol. Images were taken with an ApoTome Imaging System based on Axiovert 200M (Zeiss) using AxioVision software.
Differences in gene expression between the noradrenergic and cholinergic condition were studied in cultures of neonatal rat SCG primary neurons. In the noradrenergic condition, neuronal cultures were exposed to NGF alone whereas in the cholinergic condition primary neurons were treated with a combination of NGF and CNTF. The presence of NGF is required for neuronal survival. RNA was extracted after 7 days
To validate the microarray results, we analyzed the expression of 11 randomly picked genes by qRT-PCR using RNA samples isolated from independent SCG cultures. Table
Fold changes measured by Affymetrix Gene Chip and qRT-PCR analysis for 11 randomly picked genes.
Gene Symbol | Affymetrix | Real-Time RT-PCR | |
---|---|---|---|
Fold Change | Fold Change | S.E.M. | |
|
−1.9 | −2.9 | 0.6 |
|
−1.9 | −3.0 | 0.3 |
|
−1.8 | −2.3 | 0.3 |
|
−1.8 | −2.1 | 0.4 |
|
1.8 | 4.5 | 1.6 |
|
2.3 | 3.8 | 1.1 |
|
2.6 | 3.4 | 0.9 |
|
10.3 | 25.4 | 5.5 |
|
−1.5 | −2.9 | 0.5 |
|
3.0 | 15.3 | 2.7 |
|
4.2 | 4.6 | 0.5 |
Correlation between fold changes measured by Affymetrix Gene Chip and qRT-PCR analysis for selected genes.
Thus, we conclude that our results appropriately reflect the response of sympathetic neurons to CNTF since they can be validated by an independent method and the identified set of differentially expressed genes contains all known noradrenergic and cholinergic marker genes. However, the large number of identified differentially expressed genes indicates that neuropoietic cytokines exert a pleiotropic effect on the neurons—lots of cellular processes are likely to be activated downstream of CNTF, the cholinergic switch being only one of them. Thus, additional filtering mechanisms are required for identifying the genes that are coregulated with the neurotransmitter phenotype.
To define more precisely the transcriptional changes relevant to the sympathetic neurotransmitter switch, we used an interspecies comparison as a filter. We compared the set of CNTF-regulated genes in rat SGC neurons, identified in this study, with previously obtained expression profiles of CNTF-regulated genes in chick E12 sympathetic neurons [
First, we characterized the response to CNTF in both species by GO categorization of the differentially regulated genes (GO term Biological Process). The results of the GO analysis, including a statistical rating for the overrepresented Functional Annotation Clusters in both rat and chicken sets of genes, are given in Table
Results of the GO analysis including a statistical rating for the overrepresented Functional Annotation Clusters in both rat and chicken sets of genes.
Chick | Rat | ||||||
---|---|---|---|---|---|---|---|
Category | Term | Fold Enrichment | Benjamini | Category | Term | Fold Enrichment | Benjamini |
Annotation Cluster 1 | Enrichment Score: 6.29 | Annotation Cluster 6 | Enrichment Score: 3.32 | ||||
| |||||||
GOTERM_BP_FAT | GO:0007267~cell-cell signaling* | 2.5 | 0.00014 | GOTERM_BP_FAT | GO:0007267~cell-cell signaling* | 2.0 | 0.00100 |
GOTERM_BP_FAT | GO:0019226~transmission of nerve impulse | 2.6 | 0.00016 | GOTERM_BP_FAT | GO:0019226~transmission of nerve impulse | 1.8 | 0.04829 |
GOTERM_BP_FAT | GO:0050877~neurological system process | 2.0 | 0.00013 | GOTERM_BP_FAT | GO:0050877~neurological system process | 1.4 | 0.09617 |
GOTERM_BP_FAT | GO:0007268~synaptic transmission | 2.5 | 0.00171 | GOTERM_BP_FAT | GO:0007268~synaptic transmission | 1.7 | 0.15680 |
| |||||||
Annotation Cluster 2 | Enrichment Score: 4.82 | Annotation Cluster 4 | Enrichment Score: 4.92 | ||||
| |||||||
GOTERM_BP_FAT | GO:0048545~response to steroid hormone stimulus* | 2.5 | 0.00013 | GOTERM_BP_FAT | GO:0009719~response to endogenous stimulus* | 1.7 | 0.00034 |
GOTERM_BP_FAT | GO:0032355~response to estradiol stimulus | 4.1 | 0.00052 | GOTERM_BP_FAT | GO:0010033~response to organic substance | 1.5 | 0.00058 |
GOTERM_BP_FAT | GO:0009725~response to hormone stimulus | 2.0 | 0.00093 | GOTERM_BP_FAT | GO:0009725~response to hormone stimulus | 1.7 | 0.00480 |
GOTERM_BP_FAT | GO:0010033~response to organic substance | 1.7 | 0.00097 | GOTERM_BP_FAT | GO:0048545~response to steroid hormone stimulus | 1.8 | 0.01490 |
GOTERM_BP_FAT | GO:0043627~response to estrogen stimulus | 3.0 | 0.00163 | ||||
GOTERM_BP_FAT | GO:0009719~response to endogenous stimulus* | 1.8 | 0.00283 | ||||
GOTERM_BP_FAT | GO:0031960~response to corticosteroid stimulus | 2.7 | 0.01533 | ||||
GOTERM_BP_FAT | GO:0051384~response to glucocorticoid stimulus | 2.7 | 0.02100 | ||||
| |||||||
Annotation Cluster 5 | Enrichment Score: 4.33 | Annotation Cluster 3 | Enrichment Score: 5.63 | ||||
| |||||||
GOTERM_BP_FAT | GO:0022610~biological adhesion* | 2.2 | 0.00052 | GOTERM_BP_FAT | GO:0007155~cell adhesion* | 2.0 | 0.00006 |
GOTERM_BP_FAT | GO:0007155~cell adhesion* | 2.2 | 0.00052 | GOTERM_BP_FAT | GO:0022610~biological adhesion* | 2.0 | 0.00006 |
GOTERM_BP_FAT | GO:0016337~cell-cell adhesion | 1.9 | 0.19556 | GOTERM_BP_FAT | GO:0016337~cell-cell adhesion | 2.0 | 0.04376 |
| |||||||
Annotation Cluster 7 | Enrichment Score: 4.1 | Annotation Cluster 2 | Enrichment Score: 5.80 | ||||
| |||||||
GOTERM_BP_FAT | GO:0030182~neuron differentiation* | 2.1 | 0.00049 | GOTERM_BP_FAT | GO:0030182~neuron differentiation* | 2.1 | 0.00001 |
GOTERM_BP_FAT | GO:0048812~neuron projection morphogenesis | 2.7 | 0.00119 | GOTERM_BP_FAT | GO:0048666~neuron development | 2.3 | 0.00002 |
GOTERM_BP_FAT | GO:0032989~cellular component morphogenesis | 2.1 | 0.00162 | GOTERM_BP_FAT | GO:0031175~neuron projection development | 2.3 | 0.00008 |
GOTERM_BP_FAT | GO:0048858~cell projection morphogenesis | 2.5 | 0.00173 | GOTERM_BP_FAT | GO:0030030~cell projection organization | 2.1 | 0.00006 |
GOTERM_BP_FAT | GO:0000904~cell morphogenesis involved in differentiation | 2.5 | 0.00191 | GOTERM_BP_FAT | GO:0048812~neuron projection morphogenesis | 2.5 | 0.00014 |
GOTERM_BP_FAT | GO:0000902~cell morphogenesis | 2.2 | 0.00193 | GOTERM_BP_FAT | GO:0048858~cell projection morphogenesis | 2.4 | 0.00018 |
GOTERM_BP_FAT | GO:0048666~neuron development | 2.1 | 0.00303 | GOTERM_BP_FAT | GO:0032990~cell part morphogenesis | 2.3 | 0.00047 |
GOTERM_BP_FAT | GO:0032990~cell part morphogenesis | 2.4 | 0.00297 | GOTERM_BP_FAT | GO:0000902~cell morphogenesis | 2.0 | 0.00060 |
GOTERM_BP_FAT | GO:0048667~cell morphogenesis involved in neuron differentiation | 2.4 | 0.01158 | GOTERM_BP_FAT | GO:0000904~cell morphogenesis involved in differentiation | 2.2 | 0.00099 |
GOTERM_BP_FAT | GO:0031175~neuron projection development | 2.1 | 0.01179 | GOTERM_BP_FAT | GO:0007409~axonogenesis | 2.4 | 0.00095 |
GOTERM_BP_FAT | GO:0006928~cell motion | 1.9 | 0.01572 | GOTERM_BP_FAT | GO:0032989~cellular component morphogenesis | 1.9 | 0.00168 |
GOTERM_BP_FAT | GO:0030030~cell projection organization | 1.9 | 0.01716 | GOTERM_BP_FAT | GO:0048667~cell morphogenesis involved in neuron differentiation | 2.2 | 0.00545 |
GOTERM_BP_FAT | GO:0007409~axonogenesis | 2.3 | 0.03259 | GOTERM_BP_FAT | GO:0007411~axon guidance | 1.9 | 0.39703 |
GOTERM_BP_FAT | GO:0007411~axon guidance | 2.3 | 0.25197 | ||||
| |||||||
Annotation Cluster 8 | Enrichment Score: 3.19 | Annotation Cluster 8 | Enrichment Score: 3.03 | ||||
| |||||||
GOTERM_BP_FAT | GO:0006928~cell motion* | 1.9 | 0.01572 | GOTERM_BP_FAT | GO:0006928~cell motion* | 1.75553 | 0.014535426 |
GOTERM_BP_FAT | GO:0016477~cell migration | 2.1 | 0.02150 | GOTERM_BP_FAT | GO:0016477~cell migration | 1.8 | 0.04952 |
GOTERM_BP_FAT | GO:0051674~localization of cell | 2.0 | 0.03139 | GOTERM_BP_FAT | GO:0051674~localization of cell | 1.7 | 0.09427 |
GOTERM_BP_FAT | GO:0048870~cell motility | 2.0 | 0.03139 | GOTERM_BP_FAT | GO:0048870~cell motility | 1.7 | 0.09427 |
| |||||||
Annotation Cluster 11 | Enrichment Score: 2.96 | Annotation Cluster 1 | Enrichment Score: 6.19 | ||||
| |||||||
GOTERM_BP_FAT | GO:0001944~vasculature development* | 2.2 | 0.01832 | GOTERM_BP_FAT | GO:0001944~vasculature development* | 2.5 | 0.00005 |
GOTERM_BP_FAT | GO:0048514~blood vessel morphogenesis | 2.3 | 0.024790429 | GOTERM_BP_FAT | GO:0001568~blood vessel development | 2.5 | 0.00006 |
GOTERM_BP_FAT | GO:0001568~blood vessel development | 2.1 | 0.026514792 | GOTERM_BP_FAT | GO:0048514~blood vessel morphogenesis | 2.6 | 0.00008 |
GOTERM_BP_FAT | GO:0001525~angiogenesis | 2.3 | 0.118658169 | GOTERM_BP_FAT | GO:0001525~angiogenesis | 2.4 | 0.02003 |
*Identical GO categories overrepresented in the two groups of differentially expressed genes including synaptic transmission, neuron differentiation, neuron development, cell adhesion, and cell migration.
Next, we defined how many orthologous genes are present in both datasets (Table
Chick |
Rat | |||
---|---|---|---|---|
Number | Percentage (%) | Number | Percentage (%) | |
Probe sets | 37693 | 31042 | ||
Genes | 18043 | 16084 | ||
Annotated CNTF-regulated genes (FDR < 1%, 1.5-fold change threshold) | 982 |
|
1120 |
|
Without orhologue or probe set on the other chip | 364 |
|
318 |
|
With ortologue/probe set | 618 |
|
802 |
|
Regulated in one species and not in the other | 459 |
|
643 |
|
Regulated in both species—opposite direction | 65 |
|
65 |
|
Regulated in both species—same direction | 94 |
|
94 |
|
Of the 802 comparable loci, 643 (80.2%) were not differentially regulated by CNTF in the chicken model and 65 genes (8.1%) were regulated in the opposite direction in the two species (Table
In the avian
The unexpected, very limited overlap, observed in the interspecies comparison, raised the question whether it is explained by differences in the experimental conditions of the two model systems. To address this question, we randomly chose several differentially expressed genes as diagnostic markers and determined their expression after varying individual parameters of the culture conditions, for example, dissociated versus ganglionic explants cultures, presence versus absence of NGF in the CNTF condition, and anatomical localization—using SCG versus paravertebral ganglia. None of these parameters explained the differences between the species for the tested marker set.
An alternative explanation for the differential response to cholinergic differentiation factors is that the two
Representative images of sections of E18 (a) and P40 (b) rat stellate ganglia immunostained for
The dataset associated with this Dataset Paper consists of 4 items which are described as follows.
In this work, we analyzed the global transcriptome changes that occur in rat SCG sympathetic neurons after stimulation with CNTF—the classical cell-culture model of the neuropoietic cytokine-dependent neurotransmitter switch. The comparison of the genes identified in this study with the expression changes induced by cholinergic differentiation factors in avian sympathetic neurons revealed major interspecies differences and a surprisingly limited overlap. Since the differences in the CNTF-induced gene programs between the two species are not attributable to differences in the experimental conditions, it can be speculated that they in fact reflect the heterogeneity in the mechanisms of cholinergic differentiation in the sympathetic nervous system. At least two mechanisms seem to be at work at different developmental stages with regard to the acquisition of the cholinergic properties [
The dataset associated with this Dataset Paper is dedicated to the public domain using the
This study was supported by a grant from the FWF (Signal Processing in Neurons W1206-B05). The