Traditional Chinese medicine (TCM) syndrome is an important basis for TCM diagnosis and treatment. As Child-Pugh classification as well as compensation and decompensation phase in liver cirrhosis, it is also an underlying clinical classification. In this paper, we investigated the correlation between single nucleotide polymorphisms (SNPs) of Interleukin-10 (IL-10) and TCM syndromes in patients with hepatitis B cirrhosis (HBC). Samples were obtained from 343 HBC patients in China. Three SNPs of IL-10 (−592A/C, −819C/T, and −1082A/G) were detected with polymerase chain-reaction-ligase detection reaction (PCR-LDR). The result showed the SNP-819C/T was significantly correlated with Deficiency syndrome (
Hepatitis B virus (HBV) infection is a major health problem in China. It is one of the major causes of virus-related liver diseases such as liver cirrhosis (LC) and hepatocellular carcinoma (HCC) [
DNA sequence and its variations are reflecting the human evolutionary process. SNP is a variation occurring when a single nucleotide in the genome (or other shared sequence) differs between members of a biological species or paired chromosomes in an individual [
The classification of disease is an important basis for the diagnosis of disease. In the LC, the phenotypes have been used to the classification, such as Child-Pugh classification, compensation and decompensation phase, hepatocellular function, and traditional Chinese medicine (TCM) syndromes. The TCM syndrome, also called ZHENG or TCM pattern, is the basic unit and the key concept in TCM theory. All diagnostic and therapeutic methods in TCM are based on the differentiation of ZHENG [
In this study, we investigated the correlation between the IL-10 gene SNPs and phenotypes, which include TCM syndromes, Child-Pugh classification, and compensation or decompensation phase in HBC patients.
In this study, 343 patients were recruited from Longhua Hospital, Shuguang Hospital, Yueyang Hospital and Putuo Hospital in Shanghai, the First Affiliated Hospital of Henan University of TCM and Ruikang Hospital in Guangxi in China. The patients were selected based on their age, gender, disease classification and area distribution (Table
Clinical data of 343 HBC patients.
Gender | No (%) |
Male | 242 (70.55) |
Female (%) | 101(29.45) |
Mean age (yr) | |
Child-Pugh-Turcotte score (%) | |
A | 240 (69.97) |
B | 75 (21.87) |
C | 28 (8.16) |
Phase (%) | |
Compensation phase | 203 (59.18) |
Decompensation phase | 140 (40.82) |
Area (%) | |
Shanghai | 226 (65.89) |
Guangxi | 69 (20.12) |
Henan | 48 (13.99) |
The patients were divided into class A, class B, and class C according to Child-Pugh-Turcotte (CPT) score, and the CPT score was calculated by rating the following five parameters including serum levels of bilirubin and albumin, prothrombin time, ascites, and encephalopathy [
The clinical information of HBC patients such as symptoms and signs was collected from the above 6 hospitals, and then TCM syndromes were classified into Excess, Deficiency, and Deficiency-Excess syndromes by 3 TCM senior physicians according to the define of diagnosis, and TCM syndrome differentiation of liver cirrhosis [
Blood samples of all the patients were collected in K2EDTA tubes. Genomic DNA was selected from 1 mL peripheral blood of each sample, using the TIANamp Blood DNA Kit (Tiangen Biotech, Beijing, China). Subsequently, the DNA was stored at −80°C for following genotype analysis.
Firstly, the genomic DNA extracted from clinical samples was subjected to a multiplex PCR (Invitrogen, Carlsbad, CA). Briefly, 1
The gene position, polymorphism, primer sequences, and gene frequencies of IL-10 SNPs.
Gene position | Rs number | Polymorphism | Primer sequence | Gene frequencies (%) |
---|---|---|---|---|
IL-10-592 A/C | rs1800872 | A/C | F: AAGAGGTGGAAACATGTGCC | 22.20 |
R: TACCCAAGACTTCTCCTTGC | ||||
IL-10-819 C/T | rs1800871 | C/T | F: ATGGTGTACAGTAGGGTGAG | 57.70 |
R: TTTCCACCTCTTCAGCTGTC | ||||
IL-10-1082 A/G | rs1800896 | A/G | F: AGAAGTCCTGATGTCACTGC | 15.10 |
R: AAGTCAGGATTCCATGGAGG |
Secondly, LDR assays were carried out using conditions similar to those described elsewhere with slight modifications [
The LDR probes for IL-10 detection.
Gene position | Probes sequence |
---|---|
IL-10-592 A/C | A60-S7-TA: TTTTTTTTAACACATCCTGTGACCCCGCGTGTA |
A60-S7-TC: TTTTTTTTTTTAACACATCCTGTGACCCCGCGTGTC | |
A60-S7-TR: -P-CTGTAGGAAGCCAGTCTCTGGAAAGTTTTTT-FAM- | |
IL-10-819 C/T | A60-S6-TC: TGTACCCTTGTACAGGTGAAGTAAC |
A60-S6-TT: TTTTGTACCCTTGTACAGGTGAAGTAAT | |
A60-S6-TR: -P-ATCTCTGTGCCTCAGTTTGCTCACT-FAM- | |
IL-10-1082 A/G | A60-S5-TA: AACACTACTAAGGCTTCTTTCGGAA |
A60-S5-TG: TTTAACACTACTAAGGCTTCTTTCGGAG | |
A60-S5-TR: -P-GGGGAAGTAGGGATAGGTAAGAGGA-FAM- |
Lastly, the mixture of 1
Additionally, about 5% of the samples were randomly selected and retested by direct DNA sequencing in Shanghai National Biochip Research Center Laboratory, and the results were concordant with PCR-LDR.
The data determined by the frequency of genotype obeyed the Hardy-Weinberg equilibrium (HWE) between the observed and expected genotype values. The correlation between genotypes and phenotypes was compared by the
The frequencies of 3 SNPs loci of IL-10 were assessed in 343 HBC patients in China. The Hardy-Weinberg equilibrium (HWE) test showed that the distribution of these tested genotypes was not significantly different from the expected distribution (
As shown in Table
Correlation between IL-10 genotypes and Child-Pugh classification or compensation and decompensation phase in HBC patients.
Gene/genotype | Child-Pugh classification | | Phase | ||||
Class A (%) ( | Class B (%) ( | Class C (%) ( | Compensation ( | Decompensation ( | |||
IL-10-592 A/C | |||||||
AA | 104 (43.7) | 35 (46.7) | 13 (46.4) | 0.839 | 83 (40.9) | 69 (50.0) | 0.072 |
AC | 108 (45.4) | 35 (46.7) | 13 (46.4) | 95 (46.8) | 61 (44.2) | ||
CC | 26 (10.9) | 5 (6.7) | 2 (7.1) | 25 (12.3) | 8 (5.8) | ||
IL-10-819C/T | |||||||
TT | 114 (47.5) | 36 (48.0) | 12 (42.9) | 0.770 | 90 (44.3) | 72 (51.4) | 0.076 |
CT | 103 (42.9) | 32 (42.7) | 15 (53.6) | 89 (43.8) | 61 (43.6) | ||
CC | 23 (9.6) | 7 (9.3) | 1 (3.6) | 24 (11.8) | 7 (5.0) | ||
IL-10-1082A/G | |||||||
AA | 212 (88.3) | 65 (86.7) | 22 (78.6) | 0.340* | 182 (89.7) | 177 (88.5) | 0.710* |
AG | 27 (11.3) | 10 (13.3) | 6 (21.4) | 20 (9.9) | 23 (11.5) | ||
GG | 1 (0.4) | 0 (0) | 0 (0) | 1 (0.5) | 0 (0) |
*Between AA and AG + GG of IL-10-1082A/G.
The correlation was analyzed between IL-10 genotypes (−592A/C, −819C/T, and −1082A/G) and TCM syndromes in HBC patients. As shown in Table
Correlation between IL-10 genotypes and TCM syndromes in HBC patients.
TCM syndrome type | IL-10-592 | IL-10-819 | IL-10-1082 | ||||||
---|---|---|---|---|---|---|---|---|---|
AA | AC + CC | TT | TC + CC | GG | AG + AA | ||||
Excess syndrome | 197 | 29 | 0.999 | 111 | 112 | 0.600 | 22 | 203 | 0.969 |
Deficiency-Excess syndrome | 41 | 7 | 0.735 | 27 | 24 | 0.470 | 4 | 49 | 0.621 |
Deficiency syndrome | 61 | 8 | 0.778 | 23 | 46 | 7 | 56 | 0.726 | |
Total | 299 | 44 | 163 | 180 | 33 | 308 |
To further clarify the correlation between Excess syndrome or Deficiency syndrome and clinical data and IL-10 SNPs in HBC patients, the binary logistic regression analysis was carried out. The analytic parameters were including age, gender, IL-10 SNPs loci (−592A/C, −819C/T, and −1082A/G), clinical symptoms and signs (fatigue, poor appetite, abdominal distension, backache, limp aching knees, dry eyes, dizzy, pruritus, yellow urine, aversion to cold, loose stools, spider nevus, ascites) and hepatocellular function parameters (ALT, AST, bilirubin and albumin, prothrombin time). The results showed that the Excess syndrome was associated with dizzy and spider nevus (Table
Correlation between Excess or Deficiency syndrome and clinical data and IL-10 gene SNPs in HBC patients.
Factors | B | SE | Wald | OR | 95%CI | ||
Lower | Upper | ||||||
Excess syndrome | |||||||
Abdominal distension | 0.277 | 0.148 | 3.509 | 0.061 | 1.319 | 0.987 | 1.763 |
Dizzy | 0.658 | 0.203 | 10.458 | 0.001 | 1.931 | 1.296 | 2.876 |
Spider nevus | 0.385 | 0.180 | 4.594 | 0.032 | 1.469 | 1.033 | 2.089 |
Constant | 0.173 | 0.199 | 0.755 | 0.385 | 1.189 | ||
Deficiency syndrome | |||||||
Dry eyes | 0.448 | 0.191 | 5.518 | 0.019 | 1.566 | 1.077 | 2.276 |
Aversion to cold | 0.605 | 0.203 | 8.868 | 0.003 | 1.830 | 1.230 | 2.725 |
IL-10-819C/T | 1.392 | 0.442 | 9.921 | 0.002 | 4.022 | 1.692 | 9.563 |
IL-10-1082A/G | −0.903 | 0.430 | 4.415 | 0.036 | 0.406 | 0.175 | 0.941 |
Constant | −1.163 | 0.777 | 2.240 | 0.134 | 0.313 |
TCM syndrome classification, also defined as ZHENG differentiation, is the basic concept in the TCM theory. TCM syndrome, a profile of symptoms and signs as a series of clinical phenotypes, plays an important role in understanding the human homeostasis and guiding the applications of TCM treatment. All diagnostic and therapeutic methods in TCM are based on the differentiation of the TCM pattern, and this concept has been used for thousands of years in China [
IL-10 is an important immunoregulatory cytokine mainly produced by activated T cells, monocytes, B cells, and thymocytes. As an immune response modulator, IL-10 can both stimulate and suppress the immune response [
Previous studies have shown that TCM syndrome is associated with gene SNPs. For example, the people with 5-HTTLPR SS genotype polymorphism may be the susceptible population of Excess of liver Yang syndrome [
In this study, therefore, to further investigate whether IL-10 genotypes correlated really to TCM syndromes, more samples from different area (Shanghai, Henan and Guangxi in China) were applied, compared to Child-Pugh classification and compensation or decompensation phase. The results showed that IL-10-819C/T locus was significantly correlated to Deficiency syndrome (
Though our results showed that IL-10 genotype might correlate with Deficiency syndrome in HBC patients, it is difficult to understand the relationship between IL-10 SNPs and TCM syndromes, while TCM syndrome changes following patient’s condition and disease situation. In recent years, following the implementation of Human Genome Project and high throughput Genomic strategies, a large number of human complex diseases associated genetic variants have been identified through Genome-wide association studies (GWAS) [
In this study, we identified that IL-10-819C/T locus was significantly correlated to Deficiency syndrome, and the OR value was 4.022, and indicated that HBC patients with the CC genotype plus TC genotype at IL-10-819C/T might correlate with the risk in the occurrence of Deficiency syndrome.
This paper was supported by National Science and Technology Major Project of China (no. 2012ZX10005001-004), National Natural Science Funds (no. 81073134), Leading Academic Discipline Project of Shanghai Municipal Education Commission (no. J50301), and E-institutes of Shanghai Municipal Education Commission (no. E 03008).