Many traditional Chinese medicine (TCM) formulae have been used in cancer therapy. The JIN formula is an ancient herbal formula recorded in the classic TCM book
Nonsmall cell lung cancer is a major cause of cancer-related mortality worldwide and is highly resistant to treatment by classical cytotoxic agents including platinum-based drugs. Traditional Chinese medicine (TCM) aims to correct maladjustments and restore the self-regulatory ability of the body without antagonizing specific pathogenic targets. TCM has been used to treat human diseases and has a long history of safety and efficacy. The approaches used in systems biology and pharmacogenetics are similar to the practices of TCM [
Human lung carcinoma (NCI-H460) cells were obtained from the Cell Line Bank (Shanghai, China) and used in the described experiments. The cell line was cultured in Dulbecco’s modified Eagle’s medium (Gibco, USA) with 10% fetal bovine serum, 100 U/mL penicillin, and 100 mg/mL streptomycin in a cell culture incubator at 37°C under 5% CO2. The cells were used within 2 passages to 4 passages at the log phase of growth. Aliquots of the cell line were frozen at −80°C until use.
Balb/c athymic (nude) mice (male, 6 wk to 8 wk,
The tumor regression model was successfully applied in nude mice to evaluate antitumor activity. This model was used to evaluate the suppression of solid tumor growth by the JIN formula. A total of 1 × 107 NCI-H460 cells in 0.2 mL of culture medium were injected subcutaneously into the flank of each mouse by using a 26 ga needle. After 7 d of observation, a solid tumor mass was excised from the mice inoculated with NCI-H460 cells. When the tumor volume in the nude mice reached approximately 50 mm3, the xenografted tumor models were randomly distributed into four groups: NCI-H460 + saline (mock group), NCI-H460 + 12 mg/mL/d JIN formula (JIN group), NCI-H460 + 20
All animals were monitored for activity, physical condition, body weight, and tumor growth. The body weight of each animal was measured once every 3 d. The longest (
Total RNA from the xenografted tumor was isolated with TRIZOL reagent (Invitrogen Life Technologies). We pooled an equal amount of cancer tissues from six individual mouse xenografts in each group (JIN, DPP, JIN + DDP, and the mock groups) to save cost. The RNA was eluted in RNase-free water, and the integrity was verified by electrophoresis on 1.2% agarose gel and visualized with ethidium bromide staining. The concentration was quantified by ultraviolet absorption with a nanodrop spectrophotometer (BioLab Ltd.).
The total RNA from the experimental samples was used as a template and reverse-transcribed to generate cDNA. The cDNA was then converted into biotin-labeled cRNA probes by using Biotin-16-dUTP (Roche) by in vitro transcription with the TrueLabeling-AMP linear RNA amplification kit (SuperArray Bioscience). Before hybridization, the cRNA probes were purified with the ArrayGrade cRNA Cleanup Kit (Superarray Bioscience).
The Oligo GEArray microarray series (OHS-044) (SuperArray Inc.) was used to quantify the expression of the 113 genes involved in the 15 signal transduction pathways in cancer (mitogen-activated protein kinase (MAPK), Wnt, hedgehog, signal transducers, and activators of transcription, stress/heat shock, inflammation/nuclear factor-kappa B, survival, androgen/estrogen, and transforming growth factor-beta (TGF-
Purified cRNA probes were hybridized with the membranes at 60°C overnight with slow agitation in a hybridization oven. The hybridized membranes were washed once in saline sodium citrate buffer solution I (2x, 1% sodium citrate/sorbitol buffer) and once in solution II (0.1x, 0.5% sodium dodecyl sulfate (SDS)). Membranes were incubated with alkaline phosphatase-conjugated streptavidin. Thereafter, the membranes were washed and incubated with the CDP-Star chemiluminescent substrate. Detection was performed by exposure to X-ray film. Membrane images were analyzed by the web-based GEArray Expression Analysis Suite software. The relative expression level of each gene was determined by comparing the signal intensity of each gene in the array after background and normalization corrections. For comparison, at least 1 spot intensity had to be more than twice the background intensity, and the spot intensity ratios had to be higher than 2 (for upregulation) or lower than 0.5 and higher than 0 (for downregulation).
PCR primers were designed by using the Primer 5.0 software (Primer, Canada) based on the special design criteria for real-time PCR primers (Table
Description of the primer sequences.
Gene | Forward and reverse primer sequences | Annealing temperature (°C) | Length of amplified product (bp) |
---|---|---|---|
|
F: 5′CCTGTACGCCAACACAGTGC3′ | 59 | 211 |
R: 5′ATACTCCTGCTTGCTGATCC3′ | |||
|
F: 5′CTGCGGTGAGCCAATTTAGAG3′ | 59 | 231 |
R: 5′CCTTGGGACCAGTGTACCTTCT3′ | |||
|
F:5′GGCTTCGTGCTTACTTCCA3′ | 59 | 259 |
R: 5′TGGCGTGCGGTCTGTAT3′ |
For the proteomic analysis, we pooled an equal amount of cancer tissues from six individual mouse xenografts in each group (JIN, DPP, and the mock groups) to save cost. Cancer tissues were snap-frozen in liquid nitrogen and stored in a −80°C freezer. To extract proteins, the cancer tissues were grinded under liquid nitrogen with a mortar and pestle, and tissue lysis buffer was added. The solution was then sonicated on ice with an ultrasonic processor (Bioblock Scientific, France) for 90 min. The tissue lysis buffer contained 50 mM Tris (pH 7.4), 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 1x cocktail (0.5 mM Na3VO4, 50 mM NaF, 1x phosphatase inhibitor cocktail, and 5 mM phenylmethanesulfonyl fluoride). The homogenate was then centrifuged at 12,000 g for 1 h at 4°C. Supernatant was collected, and protein concentration was determined by bicinchoninic acid assay. Each sample (70
Tryptic peptide mixtures were separated by Ettan multidimensional liquid chromatography (LC) nanoflow/capillary LC system (GE Healthcare, Pittsburgh, PA, USA) equipped with a trapping column (Dionex/LC Packings
The Extract-MSn of BioWorks V3.2 (Thermo Electron, Inc., Waltham, MA, USA) was used to generate the mass spectrometry (MS) peak list with the default parameters. The Interactive Chemical Information System peak detection algorithm was used. The SEQUEST algorithm (Thermo Fisher Inc.) was used for the SEQUEST database search, and the spectra were searched against the IPI.HUMAN.v3.58.fasta protein database (79,794 entries) (
Carboxyamidomethyl cysteine (Cys_CAM) (+57) was included as a fixed modification for iodoacetamide reduction and alkylation. Given that the proteins were prepared by polyacrylamide gel electrophoresis, cysteines might react with free acrylamide monomers to form propionamide cysteine (Cys_PAM). We included an optional 14 Da in the search to account for potential Cys_PAM. The mass difference between Cys_PAM and Cys_CAM is 14. Methionine oxidation (+15.999 Da) was selected as another optional modification for the database search. Proteins with ProteinProphet
The MS/MS data from the cancer and control samples were analyzed by the PeptideProphet and ProteinProphet program for statistical validation by using TPP4.31 [
Cells were lysed in NP-40 buffer (1.0% NP-40, 10 mM hydroxyethyl piperazine ethanesulfonic acid, pH 7.4, 150 mM NaCl, 5 mM NaF, 2 mM Na3VO4, 5 mM Na4P2O7, 10 g/mL aprotinin, 10 g/mL leupeptin, and 1 mM phenylmethylsulfonylfluoride). Equal volumes of cell lysate were subjected to SDS-polyacrylamide gel electrophoresis (12.5% gel). Proteins were then electrotransferred into a nitrocellulose membrane (GE Water and Process Technologies, USA). The membranes were blocked in a solution of 5% nonfat dry milk in Tris-buffered saline—Tween 20 buffer (20 mM Tris, pH 7.6, 500 mM NaCl, and 0.5% Tween 20) for 30 min followed by incubation with a primary antibody for at least 2 h. The membrane was then washed and treated with horseradish peroxidase-conjugated anti-mouse immunoglobulin or anti-rabbit immunoglobulin as indicated. Immunodetection was performed by using West Pico (Pierce Chemical, Rockford, IL) or West Dura (Pierce Chemical) followed by imaging on an Image Station 2000R (Eastman Kodak, USA).
The data were analyzed by SPSS 19 software and presented as mean ± standard deviation. The significance of the difference between the mean of the mock and treatment groups was analyzed by using one-way ANOVA followed by Dunnett’s
To study the toxicity of the JIN formula, we treated NCI-H460 xenografts that were grown subcutaneously in nude mice with saline, JIN formula, DDP, and JIN formula + DDP (coformulated group) for 15 d. A control group with no tumor was also included. One mouse in the mock group died on the 11th day of treatment. A mouse in the DDP and coformulated group died on the 15th day before sacrifice. Other mice in these two groups significantly lost weight and displayed slower activities and dry skins. All mice in the JIN group were alive and had stable weights, normal activities, and moist skins (Figure
Body weights were measured every 3 days and body weight ratio was calculated relative to baseline measurement. The chemotherapy showed the toxicity to the mice, whereas the herbal treatment showed little toxicity compared to the saline group as measured by body weight loss.
This result indicated that herbal treatment and chemotherapy prolonged the lifespan of the mice. However, chemotherapy is toxic to the mice, whereas herbal treatment showed little toxicity compared with the saline group as demonstrated by the body weight loss.
All treatment groups (DDP, JIN, and JIN + DDP) showed inhibited growth of the NCI-H460 cell-transplanted solid tumor compared with the mock group (Figure
Effect of treatment on tumour growth. (a) The effect of JIN, JIN + DDP, and DDP on tumour size. Tumour volumes were measured every 3 days. (b) The effect of JIN, JIN + DDP, and DDP on tumour weight. Data presented are the mean ± SD at 8–25 days posttumour implantation; groups were compared and analysed using
Histological examination showed that the tumors of the mock group were solid masses composed of densely arranged cells without distinct cell differentiations. The cells were heteromorphic and had large nuclei that contain vesicles and obvious nucleoli. Reverse proportions between the nucleus and cytoplasm, high rates of mitosis and angiogenesis, infiltrative growths of tumor cells, and large areas of necrosis and hemorrhage were observed. No significant difference in cell morphology was found between each treatment group and the mock group. However, the tumor cells in the treatment group were less densely arranged, with patchy sparse cell arrangements, enlarged intercellular spaces, vacuoles in the cytoplasms, scattered intense stains in nuclei, scattered pyknosis of tumor cells, and varying degrees of degeneration. Tumor cell metastasis was not found in the lungs and liver (data not shown). The results indicated that the formula can promote the degeneration and death of tumor cells and induce apoptosis, thus inhibiting the growth of lung cancer. These data suggested that the JIN formula could be safely administered as a novel therapeutic agent. Optimization of the dose and dosing schedule might yield a higher antitumor efficacy (Figure
(a) MOCK group; (b) JIN group; (c) DDP group; (d) JIN + DDP group. Histological examination showed the tumors of MOCK group were solid masses composed of densely arranged cells without distinct cell differentiation, which are heteromorphic with a large nucleus containing vesicles and an obvious nucleolus, a reverse proportion between nucleus and cytoplasm, much mitosis and angiogenesis, infiltrative growth of tumor cells, and large areas of necrosis and hemorrhage.
To investigate preferentially altered signal transduction pathways in H460 xenografted tumors treated by herbal formula, the Human Q Series Signal Transduction in Cancer Gene Array, which includes marker genes with functions related to cell signal transduction pathways, was used. In the JIN group, the
Genes regulated more than 2 folds by JIN treatment in H460 cells.
GeneBank | Symbol | Description | JIN/MOCK |
|
---|---|---|---|---|
NM_000076 |
|
Cyclin-dependent kinase inhibitor 1C (p57, Kip2) | 2.72 | 0.01 |
NM_003738 |
|
Patched homolog 2 (Drosophila) | 0.45 | 0.04 |
NM_003202 |
|
Transcription factor 7 (T-cell specific, HMG-box) | 0.39 | 0.02 |
NM_015626 |
|
WD repeat and SOCS box-containing 1 | 0.13 |
|
Genes regulated more than 2 folds by DDP treatment in H460 cells.
GeneBank | Symbol | Description | DDP/MOCK |
|
---|---|---|---|---|
NM_002423 | MMP7 | Matrix metallopeptidase7 (matrilysin, uterine) | 3.16 | 0.003 |
NM_001429 | EP300 | E1A binding protein p300 | 0.35 | 0.008 |
NM_022475 | HHIP | Hedgehog interacting protein | 0.26 | 0.02 |
NM_015626 | WSB1 | WD repeat and SOCS box-containing 1 | 0.13 |
|
(a) Genes regulated more than 2 folds by Jin treatment on H460 cells. Combined with ratio values 2-fold difference, in JIN group, significantly upregulated gene
Furthermore, the coformula treatment of JIN and DDP also inhibited the stress/heat shock pathway, which involves the
Genes regulated more than 2 folds by JIN + DDP treatment in H460 cells.
GeneBank | Symbol | Description | JIN + DDP/MOCK |
|
---|---|---|---|---|
NM_000076 | CDKN1C | Cyclin-dependent kinase inhibitor 1C (p57, Kip2) | 3.24 | 0.003 |
NM_001904 | CTNNB1 | Catenin (cadherin-associated protein), beta 1, 88 kDa | 0.26 | 0.003 |
NM_005228 | EGFR | Epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) | 0.46 | 0.05 |
NM_001429 | EP300 | E1A binding protein p300 | 0.35 | 0.007 |
NM_005252 | FOS | V-fos FBJ murine osteosarcoma viral oncogene homolog | 0.46 | 0.03 |
NM_002133 | HMOX1 | Hemeoxygenase (decycling) 1 | 0.42 | 0.09 |
NM_005526 | HSF1 | Heat shock transcription factor 1 | 0.44 | 0.02 |
NM_002467 | MYC | V-myc myelocytomatosis viral oncogene homolog (avian) | 0.22 | 0.0008 |
NM_003738 | PTCH2 | Patched homolog 2 (Drosophila) | 0.40 | 0.01 |
NM_003202 | TCF7 | Transcription factor 7 (T-cell specific, HMG-box) | 0.32 | 0.006 |
NM_015626 | WSB1 | WD repeat and SOCS box-containing 1 | 0.13 |
|
We conducted a comprehensive mass spectra analysis of the JIN formula, DDP, and mock groups. We identified 1,131, 831, and 1,326 proteins in the JIN formula, DDP, and mock groups, respectively. By using Booth’s Bayesian mixture model to compare the spectral count data for shotgun proteomics [
GoMiner analysis revealed that the differentially expressed proteins between the JIN and mock groups were enriched in GO:0006977 (DNA damage response signal transduction by p53 class mediator resulting in cell cycle arrest), GO:0006915 (apoptosis), and GO:0016032 (viral reproduction) (Table
Significantly enriched GO Biological process terms in the differentially expressed proteins between the JIN formula and the MOCK groups.
GO category | Description | Total genes | Changed genes | Enrichment |
|
---|---|---|---|---|---|
GO:0044237 | Cellular metabolic process | 4513 | 45 | 1.40 | −3.26 |
GO:0044249 | Cellular biosynthetic process | 2322 | 26 | 1.58 | −2.22 |
GO:0006139 | Nucleobase nucleoside nucleotide and nucleic acid metabolic process | 2350 | 26 | 1.56 | −2.14 |
GO:0016032 | Viral reproduction | 343 | 16 | 6.56 | −8.93 |
GO:0034621 | Cellular macromolecular complex subunit organization | 364 | 14 | 5.41 | −6.76 |
GO:0006915 | Apoptosis | 784 | 13 | 2.33 | −2.53 |
GO:0006414 | Translational elongation | 97 | 12 | 17.41 | −11.62 |
GO:0006977 | DNA damage response signal transduction by p53 class mediator resulting in cell cycle arrest | 57 | 4 | 9.88 | −3.16 |
GO:0072395 | Signal transduction involved in cell cycle check point | 57 | 4 | 9.88 | −3.16 |
Significantly enriched GO biological process terms in the differentially expressed proteins between the DPP and the MOCK groups.
GO category | Description | Total genes | Changed genes | Enrichment |
|
---|---|---|---|---|---|
GO:0006414 | Translational elongation | 97 | 3 | 11.54 | −2.68 |
GO:0065004 | Protein-DNA complex assembly | 44 | 2 | 16.96 | −2.22 |
GO:0071824 | Protein-DNA complex subunit organization | 51 | 2 | 14.64 | −2.09 |
We identified proteins and protein families that were downregulated in the JIN group compared with these in the mock group. These proteins include several histone family proteins and two heat shock proteins (HSPs), namely, heat shock 70 kDa protein 1
Western blot analysis showing that after treated by JIN formula the HSP90AA1 was downregulated significantly than DDP did.
Chinese or oriental herbal medicine has long been used for treating cancer. Single herbs are seldom used alone compared with herbal formulae, which uses the synergy and interactions among various phytochemicals present in different herbs to achieve therapeutic efficacy and targets multiple biological and pathological processes while minimizing side effects.
TCM formulae are rich in potential cancer chemopreventive and therapeutic agents. However, rigorous and systematic evaluations are necessary to establish the efficacy of herbal formulae and transform traditional herbal practices into evidence-based medicine. We evaluated the anticancer activities of the JIN formula, which is an ancient herbal formula recorded in the classic TCM book
Gene array analysis of signal transduction in cancer showed that the JIN formula acted on multiple targets in the MAPK, hedgehog, and Wnt signaling pathways in the H460 xenografted tumor. JIN upregulated two tumor suppressors, namely, CDKN1C and interferon regulatory factor-1 (IRF-1). Abnormal cell cycle regulation is the important reason of excessive cell proliferation and tumorigenesis. Cell cycle progression is regulated by balanced interactions between cyclins and cyclin-dependent kinases (CDKs). The suppressive effect of cyclin-dependent kinase inhibitors (CDKIs) on cyclin/CDK complexes is among the many mechanisms that control normal cell cycle progression. Cell cycle progression is negatively regulated by proteins from two families, the inhibitors of cyclin-dependent kinase 4 (INK4) family [CDKN2A (p16), CDKN2B (p15), CDKN2C (p18), and CDKN2D (p19)] and the CIP/KIP family [CDKN1A (p21), CDKN1B (p27), and CDKN1C (p57)]. The protein encoded by CDKN1C is a tight-binding, strong inhibitor of several G1 cyclin/Cdk complexes and a negative regulator of cell proliferation. Mutations in this gene are implicated in sporadic cancers and the Beckwith-Wiedemann syndrome, thus suggesting that this gene is a tumor suppressor candidate [
The downregulated genes
HSPs are encoded by several gene families and have essential roles in cell survival, tumorigenesis, and tumor progression. The HSP70 family proteins, which are named according to their approximate relative molecular mass, contain at least eight members that are almost ubiquitously expressed [
HSP 90 kDa (HSP90) is a molecular chaperone that maintains the function of numerous intracellular signaling nodes utilized by cancer cells for proliferation and survival. HSP90 is also involved in a number of human pathological states such as ischemia and autoimmune diseases. Lung cancer progression is also influenced by HSP90. HSP90
We found that GO:0044237 (cellular metabolic process) and GO:0006139 (nucleobase, nucleoside, nucleotide, and nucleic acid metabolic process) (Table
Possible cell signaling network regulated by JIN formula on H460-xonografted tumor.
X. Zhang, H. Fu, and B. Lin designed the research; L. Zheng, M. Jiang, W. Zhang, H. Zhang, F. Xiong, Y. Yu, M. Chen, J. Zhou, X. Dai, and M. Wang performed the research; L. Zheng, M. Jiang, and W. Zhang contributed equally; Y. Tang, M. Jiang, G. Cheng, and J. Duan designed the herbal formula; L. Zheng, M. Jiang, W. Zhang, H. Zhang, B. Lin, and X. Zhang analyzed the data; and L. Zheng, B. Lin, H. Fu, and X. Zhang wrote the paper.
The authors thank the members of the Fu Laboratory of the Emory University and Jiangsu Key Laboratory for their research on the TCM formulae and the Nanjing University of Chinese Medicine for their assistance and enlightening discussions. This study is supported in part by the National Science and Technology Pillar Program in the 11th Five-year Plan of China (Grant no. 2006BAI11B08-01, for H. Fu and X. Zhang), Priority Academic Program Development of Jiangsu Higher Education Institution (for X. Zhang), and the Ministry of Science and Technology of China (Grant no. 2006DFA32950, for B. Lin).