Qiliqiangxin capsule (QL) was developed under the guidance of TCM theory of collateral disease and had been shown to be effective and safe for the treatment of heart failure. The present study explored the role of and mechanism by which the herbal compounds QL act on energy metabolism,
Hypertension is one of the most common cardiovascular diseases and a major cause of heart failure. Increase of pressure load due to long-term hypertension will cause myocardial fibrosis and left ventricular compensatory hypertrophy. The accompaning neurohumoral factors, endocrine and metabolic abnormalities further promote ventricular remodeling; structural changes would result in the decline in coronary flow reserve, which eventually leads to heart diastolic and systolic dysfunction [
Qiliqiangxin capsule powder was provided by Shijiazhuang Yiling Pharmaceutical Co. Ltd. The main active pharmaceutical ingredients of QL included Astragalus, Ginseng,
UPLC fingerprints of ten batches of QL capsule.
Captopril (batch number 11061511) was manufactured by Changzhou Pharmaceutical Factory. Lactic acid detection kit (Jiancheng, Nanjing; batch number 20120710); free fatty acid detection kit (Landau, UK; lot number 234892); adenosine triphosphate ATP (Lot no. 100111202), adenosine diphosphate ADP (Lot no. 10090203190), and rhodamine 123 (Rhodamine-123) were purchased from Sigma Chemical Co., adenosine monophosphate AMP (China National Institutes for Food and Drug Control, batch number 140719-200501), mitochondrial extraction kit (Beijing Solarbio Science & Technology Co., batch number 20120528). Trizol Reagent (Invitrogen); reverse transcriptase (M-MLV), ribonuclease inhibitor (RNasin), dNTP, Taq DNA polymerase, and random primers were purchased from Promega Corporation, USA; Hot Start Fluorescent PCR Core of Reagent Kits (SYBR Green I) was obtained from BBI.
Male Sprague-Dawley rats (body weight 250–270 g), 150, were provided by the Beijing Vital River Laboratory Animal Technology Co., Ltd (Animal license number: SCXK (Beijing) 2012-0001). The animals were housed at five/cage, fed with standard diet and water ad libitum, and were subject to a 12 h light and 12 h dark cycle. All animal experimental protocols were approved by Animal Care and Use Committee of Hebei Medical University and complied with laboratory animal management and use regulations. Chronic heart failure model was established by thoracic aortic coarctation (TAC) [
After treatment for six weeks, the animals were anesthetized to perform the separation of the right carotid artery and cannulation. Left ventricular systolic pressure (LVSP) and left ventricular pressure (LVP) were measured by using BL-420E polygraph (Chengdu TaiMeng Technology Corp., LTD). After collecting blood from the abdominal aorta, the heart was rapidly removed, rinsed with cold physiological saline, and water adsorbed by filter paper. The excess tissues around the hearts were removed, and hearts were weighed on a balance and then immediately put into liquid nitrogen for storage. Heart weight index was calculated using the formula: index = heart weight (HW)/body weight (BW).
Blood was stored at room temperature for 2 h and centrifuged for 10 min at 3500 rpm; the serum was then loaded into EP tube. The optical density value was measured by using the XD711 ELISA analyzer (Shanghai Xun-Da Medical Instrument Corporation Ltd.) according to the experimental method specified in the instruction of lactic acid detection kit; serum free fatty acids were measured by using Hitachi 7080 biochemical analyzer.
About 0.3 g of fresh myocardial tissue was prepared and rinsed by physiological saline. Myocardial tissue was sheared and washed with PBS buffer. Cell mass was filtered with 300 mesh metal mesh and single cell suspension was collected. The supernatant was discarded after centrifugation (1000 rpm, 5 min). Single cell suspension was adjusted to 1 × 105/mL in the culture medium. Rhodamine 123 was used as fluorescent probe (final concentration of 0.5
Fresh myocardial tissue was collected at the end of the experiment and extracted with mitochondrial extraction kit to prepare mitochondrial suspension by differential centrifugation at low temperature. Protein content in myocardial mitochondrial suspension was determined by Coomassie brilliant blue. 2.5 mL of GENMED medium liquid was added into the reaction glass tank, mixed, and sealed, and the mitochondria, State IV substrate solution and State III substrate solution were added in proper sequence as instructed by the manufacturer. Mitochondrial State III and State IV respiration rate in the closed reaction system were determined using dissolved oxygen electrolytic analyzer (ORION 4 STAR, the U.S. Thermo Electron), and mitochondrial respiratory control ratio (RCR) was calculated according to the following formula: RCR = State III respiration rate/State IV respiration rate.
The cryopreserved myocardial tissues were weighed and added 0.4 mol/L precooling perchloric acid at 5 mL/g ratio, homogenized on the ice bath, and then centrifuged at 4000 r/min for 10 min at 4°C. Supernatant (400
Total RNA of myocardial tissue was extracted using Trizol, which was then reverse transcribed into double stranded cDNA. Real-time RT-PCR was carried out using a thermocycler (ABI 7300 Real-Time PCR System, USA). PCR thermal cycling parameters were as follows: the denaturing step at 96°C for 4 min, followed by 40 cycles annealing step at 94°C 30 s, 58°C 30 s, and 72°C 30 s. Fluorescence signal was collected in each cycle of the third step 72°C 30 s. Using GAPDH gene as an internal reference and by comparing target gene expression and with Control group, the relative quantitative value (RQ value) was calculated and used for statistical analysis. The primer sequences were shown in Table
Primer for RT-PCR.
Gene | bp | GenBank ID | Primer Sequence (5′ to 3′) |
---|---|---|---|
GAPDH | 120 | NM_017008 | S: TGAACGGGAAGCTCACTGG |
A: GCTTCACCACCTTCTTGATGTC | |||
| |||
CPT-I | 87 | NM_013200.1 | S: CCA GGC AAA GAG ACA GAC TTG |
A: GCCAAACCTTGAAGAAGCGA | |||
| |||
GLUT4 | 62 | NM_012751 | S: CCC ACA AGG CAC CCT CAC TA |
A: TGC CAC CCA CAG AGA AGA TG | |||
| |||
AMPK | 133 | NM_019142.1 | S: ACA GAA GCC AAA TCA GGG ACT |
A: CAC GGA TGA GGT AAG AGA GAC T | |||
| |||
PGC-1 |
168 | NM_031347 | S: AGC CAC TAC AGA CAC CGC AC |
A: CCT TTC AGA CTC CCG CTT C |
GAPDH: glyceraldehydes 3-phosphate dehydrogenase; CPT-I: carnitine palmitoyl transferase I; GLUT4: Glucose transporter 4; AMPK: AMP-activated protein kinase; PGC-1
Myocardial tissue about 100 mg and 1ml precooled lysate were homogenised in ice bath. Supernatant was collected after centrifugation (4°C, 8000 rpm and 10 min), and the protein concentration of supernatant, measured by Nanodrop 2000 spectrophotometer, was adjusted to the final concentration of 1%. The samples were mixed with equal volumes of 5 × SDS sample buffer, and then boiled for 5 min, centrifuged, and loaded onto 12% SDS-PAGE for electrophoresis. After being transferred onto a polyvinylidene difluoride membrane (PVDF), the membranes were blocked with 5% milk tris-buffered saline-tween 20 and probed with primary antibody (1 : 1000) and HRP conjugated secondary antibody (1 : 10000), separated by extensive washings. The membrane was treated with enhanced chemiluminescence substrate and the bands on the membrane were visualized and analyzed using UVP BioImaging System.
All data were presented as mean ± standard deviation, single factor analysis of variance (ANOVA) was performed with the statistical software SPSS 17.0, Dunnertt’sT3 was used for unequal variances, and the difference was statistically significant at
The rats in each operated group manifested low activity, short of breath, poor appetite, listlessness and other symptoms of heart failure. Compared with Sham group, LVP, LVSP and heart weight indices of the rats in Model group were significantly increased (
The changes of body weight, heart weight/body weight ratio (HW/BW), LVP, and LVSP.
Group | Heart weight (mg) | Body weight (g) | HW/BW (mg/g) | LVP (mmHg) | LVSP (mmHg) |
---|---|---|---|---|---|
Sham | 1.32 ± 0.12 | 499 ± 49.3 | 2.40 ± 0.11 | 110 ± 21.0 | 105 ± 16.7 |
TAC | 1.40 ± 0.14 | 490 ± 41.2 | 3.02 ± 0.47## | 144 ± 23.9## | 133 ± 23.2## |
Captopril | 1.36 ± 0.10 | 492 ± 35.2 | 2.64 ± 0.25* | 127 ± 18.6** | 116 ± 19.1* |
QL-L | 1.33 ± 0.14 | 500 ± 52.4 | 2.67 ± 0.31* | 127 ± 13.9* | 117 ± 18.6 |
QL-M | 1.31 ± 0.20 | 503 ± 46.2 | 2.61 ± 0.35* | 125 ± 18.7** | 115 ± 13.9* |
QL-H | 1.28 ± 0.13 | 490 ± 42.0 | 2.54 ± 0.29** | 119 ± 13.9** | 103 ± 16.0** |
Sham: control group; TAC: model group; QL-L: low-dose QL group; QL-M: medium-dose QL group; QL-H: high-dose QL group;
The Sham rats and TAC rats were treaded with vehicle (0.5%CMC-Na, 10 mL/kg/d); the low-dose QL group was treated with 0.25 g/kg/day QL: the medium-dose QL group was treated with 0.5 g/kg/day QL; the high-dose QL group was treated with 1 g/kg/day QL. Captopril group was treated with 6.25 mg/kg/day Captopril. Values were expressed as mean ± standard deviation. Compared with TAC,
As shown in Figures
Serum lactate and free fatty acid content in all the six groups. (a) Serum lactate concentrations in the myocardium. (b) The content of serum free fatty acid in the myocardium. Rats were administered with vehicle (0.5% CMC-Na), QL (0.25 g/kg/d, 0.5 g/kg/d, 1 g/kg/d), or Captopril (6.25 mg/kg/d).
Compared with Sham group, myocardial mitochondrial membrane potential was declined after model establishment. After drug intervention for six weeks, myocardial mitochondrial membrane potential was significantly elevated compared with Model group (
The measurement of myocardial cells mitochondrial membrane potential (MMP) and respiratory control ratio (RCR). (a) The measurement of myocardial cells mitochondrial membrane potential. (b) Comparison of MMP in different groups. (c) Comparison of mitochondria respiratory control ratio (RCR) in different groups.
Compared with Sham group, total adenylate and energy charge values in Model group were significantly lower (
Total adenylate pool and energy charge of myocardial tissue in rats. (a) Effects of QL on the total adenylate pool in myocardial tissue. (b) Effects of QL on energy charge of myocardial tissue in rats.
Compared with Sham group, the expression levels of AMPK, PGC-1
Real-time reverse transcription RT-PCR results. (a) The expression of AMPK mRNA in the cardiac tissue in the six groups was determined by real time RT-PCR. (b) The relative expression of PGC-1
Compared with Sham group, the protein expression of PGC-1
The p-AMPK, AMPK, PGC-1
Group | p-AMPK | AMPK | PGC-1 |
CPT-I | GLUT 4 |
---|---|---|---|---|---|
Sham | 0.50 ± 0.12 | 0.67 ± 0.15 | 0.80 ± 0.12 | 1.15 ± 0.20 | 0.70 ± 0.14 |
Model | 0.31 ± 0.14 | 0.45 ± 0.17 | 0.29 ± 0.07## | 0.57 ± 0.10# | 0.39 ± 0.18# |
Captopril | 0.79 ± 0.22** | 0.57 ± 0.36 | 0.76 ± 0.09** | 1.03 ± 0.32* | 0.71 ± 0.27* |
QL-L | 0.68 ± 0.24* | 0.49 ± 0.16 | 0.35 ± 0.03 | 0.65 ± 0.17 | 0.62 ± 0.02 |
QL-M | 0.79 ± 0.11** | 0.44 ± 0.14 | 0.53 ± 0.06** | 0.93 ± 0.27 | 0.75 ± 0.15* |
QL-H | 0.94 ± 0.13** | 0.63 ± 0.22 | 0.75 ± 0.03** | 1.07 ± 0.36* | 0.81 ± 0.14** |
Sham: control group; TAC: model group; QL-L: low-dose QL group; QL-M: medium-dose QL group; QL-H: high-dose QL group; values were expressed as mean ± standard deviation. Compared with TAC,
The p-AMPK, AMPK, PGC-1
QL capsules are traditional Chinese medicine (TCM) formula, which was developed according to TCM theory. The QL has extracts obtained from 11 herbs. Pharmacological studies have found that QL contains a number of active substances such as ginseng saponin, astragalus saponin, flavonoid, cardenolide, and phenolic acid. There is a significant effect in the clinical treatment of chronic heart failure as shown in previous studies [
Failure or hypertrophic myocardium caused imbalance between demand increase and production decrease of ATP, which was the root cause of decrease in myocardial metabolic reserve and cardiac function degradation [
Myocardial remodeling can decrease oxygen level in the myocardial tissue and affects substrate oxidation, thus resulting in the reducing of aerobic metabolic efficiency and the shift of energy supply to anaerobic glycolysis. In this case, free fatty acids (FFA) and glucose aerobic oxidation are decreased, and insulin resistance may occur [
The energy metabolism in cardiac myocytes is closely related to mitochondrial function status. Mitochondrial damage and significant reduction of oxidative phosphorylation efficiency can be caused by ischemia and hypoxia and the intermediate metabolite accumulation in failing heart. There is an internal negative and external positive transmembrane potential difference in mitochondrial inner-membrane. When the membrane potential decreases uncoupling of oxidative phosphorylation, ATP depletion and increase in oxygen radicals take place, thereby inducing cardiac myocytes into the irreversible process of apoptosis. High-energy phosphate is a direct source of energy for maintaining normal life activities of myocardial cells. The adenylate pool reflected the energy reserve state and the energy metabolic state. The results from the present study showed that, compared with Sham group, mitochondrial adenylate pool and energy charge value, RCR, and membrane potential were significantly lower in Model group, which were the same as the results of Ingwall [
AMP-activated protein kinase (AMPK) is a key modulator of lipid and glucose metabolism and energy balance. When ATP level is reduced, AMPK is rapidly activated, and becomes involved in the cell energy regulation [
In summary, the improvement of cardiac energy metabolism is an important part of delaying heart failure progression. QL reduced heart weight index of rat model of TAC-induced pressure overload, improved hemodynamic parameters, and was related to the increase of myocardial high-energy phosphate content as well as the improvement of energy reserves and the metabolic state. We argue that QL may regulate the glycolipid substrate metabolism by activating AMPK/PGC-1
This research was funded by the National Basic Research Program of China (973 Program) (Grant no. 2012 CB518606). The authors are thankful to China Shijiazhuang Yiling Pharmaceutical Co., LTD. for providing the study drug (Qili Qiangxin capsule powder) and are thankful to Key Laboratory of Network Disease of Hebei Province and Key Laboratory of State Administration of Traditional Chinese Medicine (Collateral Disease of Cardiovascular) (Shijiazhuang) for their great help.