Wen-Dan Decoction (WDD), a formula of traditional Chinese medicine, has been clinically used for treating insomnia for approximately 800 years. However, the therapeutic mechanisms of WDD remain unclear. Orexin-A plays a key role in the sleep-wake cycle, while leptin function is opposite to orexin-A. Thus, orexin-A and leptin may be important factors in sleep disorders. In this study, 48 rats were divided into control, model, WDD-treated, and diazepam-treated groups. The model of insomnia was produced by sleep deprivation (SD) for 14 days. The expressions of orexin-A, leptin, and their receptors in blood serum, prefrontal cortex, and hypothalamus were detected by enzyme-linked immunosorbent assay, immunohistochemistry, and real time PCR. Open field tests showed that SD increased both crossing movement (Cm) and rearing-movement (Rm) times. Orexin-A and leptin levels in blood serum increased after SD but decreased in brain compared to the control group. mRNA expressions of orexin receptor 1 and leptin receptor after SD were decreased in the prefrontal cortex but were increased in hypothalamus. WDD treatment normalized the behavior and upregulated orexin-A, leptin, orexin receptor 1 and leptin receptor in brain. The findings suggest that WDD treatment may regulate SD-induced negative emotions by regulating orexin-A and leptin expression.
Insomnia is a common sleep disorder characterized by difficulty falling asleep, staying awake, or both [
Among many molecular factors, orexin-A and leptin have been associated with insomnia. Orexin-A is a peptide composed of 33 amino acids that have been found in cerebrospinal fluid, lateral and posterior hypothalamus, and medial thalamus [
Leptin is a polypeptide hormone encoded by the obese gene [
Currently prescribed sleep-aid medications are often associated with many side effects, including excessive drowsiness, impaired thinking, night wandering, agitation, and balance problems. However, Chinese herbal medicines exert more balanced and nourishing effects in the brain, which improve the symptoms of SD in a different way. Wen-Dan Decoction (WDD), a famous extract, has been used clinically by practitioners of traditional Chinese medicine (TCM) with an effective rate of 93.3% [
Adult male Sprague Dawley rats were purchased from Beijing Vital River Laboratory Animal Technology Limited Company (Beijing, China). Animals were held in a room with a constant temperature of
The open field test (OFT) provides a novel environment in which animal locomotion, exploration, and anxiety are measured. The open field arena
WDD is comprised of eight different Chinese medicinal herbs (Table
Composition and active compounds of WDD.
Components | Voucher specimens number | Part used | Active Compounds | Amount used (g) |
---|---|---|---|---|
|
3002305058 | Tuber | Total alkaloids | 6 |
Immature bitter orange | 100381601 | Young fruit | Flavones | 6 |
|
100580191 | Mature pericarp | Hesperidin, citrus flavonoids | 9 |
Bamboo shavings | 100382441 | Interlayer of stem | Phosphodiesterase inhibitor | 6 |
Liquorice | 100480341 | Rhizome | Triterpenoid saponins | 3 |
Ginger | 100186553 | Rhizome | Gingerol | 5 |
Poriacocos | 100382861 | Sclerotium | Polysaccharides | 4.5 |
Fructus ziziphi jujubae | 100118527 | Fruits | Alkaloid and glycoside | 5 |
Diazepam was purchased from Beijing Yimin Pharmaceutical Co. Ltd. (Beijing, China). Rat orexin-A and leptin enzyme-linked immunosorbent assay (ELISA) kits were obtained from Vector Laboratories, Inc. (Burlingame, CA, USA). The rabbit avidin-biotin-peroxidase complex (ABC) detection kit was obtained from Vector Labs, Inc. (USA) and the rabbit leptin antibody (1 : 200) was obtained from Bioss (Beijing, China). Rabbit orexin-A antibody (1 : 100) was obtained from Millipore Co. (Billerica, MA, USA). Trizol reagent was purchased from Molecular Research Center (Cincinnati, OH, USA). High-Capacity cDNA Reverse Transcription kit was purchased from Applied Biosystems (Foster City, CA, USA). KAPA SYBR FAST qPCR kit was purchased from Kapa Biosystems (Woburn, MA, USA).
After the 14-day trial, five rats from each group (control, model, diazepam-treated, and WDD-treated) were anaesthetized with an intraperitoneal injection of 10% chloral hydrate (0.35 to 0.40 mL/100 g body weight). Rats were sacrificed and blood was collected and centrifuged at 3000 rpm for 15 min. The supernatant was collected and stored at −20°C. If precipitate was found during preservation, centrifugation was repeated. Experimental procedures were conducted according to the kit instructions and the concentrations of orexin-A and leptin in serum were detected.
Expression of orexin-A and leptin in prefrontal cortex and hypothalamus were detected by immunohistochemistry on experimental day 14. Five rats in each group were anesthetized with 10% chloral hydrate (0.35 to 0.40 mL/100 g body weight) and sacrificed. The entire brains were excised and flash-frozen in liquid nitrogen and then moved to −80°C for storage. The brains were dehydrated with 30% sucrose for 24 h and embedded in optimal cutting temperature (OCT) medium after cryoprotection. Frozen brains were cut into slices of 30
Five rats in each group were randomly selected for analysis of gene expression by quantitative real-time PCR (qPCR). Total RNA from brain tissue was isolated with Trizol reagent according to the manufacturer’s protocol. Specifically, total brain tissues in Trizol reagent were homogenized. Mixtures were vortexed in the tube for 15 s and then incubated for 3 min at 20°C. The homogenates were centrifuged at 12,000
Over 40 cycles of qPCR were performed in an Applied Biosystems PCR system with the KAPA SYBR FAST qPCR kit, including SYBR Green Master mix and ROX reference dye, according to the manufacturer’s instructions. In brief, complementary DNA (cDNA) was obtained from reverse transcription of the RNA from rat brain. Values were normalized with the use of an internal control (glyceraldehyde 3-phosphate dehydrogenase; GAPDH) in each sample. PCR products were analyzed by gel electrophoresis on a 1.5% agarose gel, and the specificity of amplification was confirmed by the melting curves. Primers employed in qPCR analyses are listed in Table
Primer sequences, length of PCR products, and optimal annealing temperature for each gene used in real-time quantitative PCR.
Primer | Sequence (5′-3′) |
|
bp |
---|---|---|---|
GAPDH | F: 5′GGAAAGCTGTGGCGTGAT3′ |
60 | 308 |
|
|||
Orexin-A | F: 5′CGCCAGAAGACGTGTTCCT3′ |
60 | 88 |
|
|||
Orexin receptor 1 | F: 5′TTTCGGGAGCAGTTCAAGG3′ |
60 | 203 |
|
|||
OB-R | F: 5′GCAGTCCAGCCTACACTCTTG3′ |
60 | 171 |
Data are expressed as mean ± standard error of mean (SEM). One-way analysis of variance (ANOVA) tests were used to analyze the data with statistical package for the social sciences (SPSS) version 17.0 software. In addition, the least significant difference (LSD) method was adopted for comparisons between groups. The repeated measures procedure of the general linear model (GLM) in SPSS version 17.0 was used to conduct one-way ANOVA analysis for repeated measures data (body-weight and food intake), and multivariate analysis process of variance was used to make comparisons between groups on each time point (the LSD method).
7 days and 14 days after SD, the Cm and Rm times in the model group were significantly increased compared to the control group (
WDD treatment ameliorated SD-induced increases in Cm and Rm times.
Parameters | Groups | Before SD | 7 days after SD | 14 days after SD |
---|---|---|---|---|
Cm times | Control group | 40.9 ± 19.7 | 31.3 ± 23.1 | 8.8 ± 4.4 |
Model group | 50.2 ± 11.4 | 89.0 ± 21.3** | 53.3 ± 15.6** | |
Diazepam group | 39.4 ± 16.5 | 105.4 ± 15.0** | 44.4 ± 22.8** | |
WDD group | 45.7 ± 23.8 | 96.6 ± 35.7** | 25.0 ± 12.7*▲★★ | |
|
||||
Rm times | Control group | 7.7 ± 4.4 | 2.1 ± 1.8 | 1.0 ± 1.0 |
Model group | 6.4 ± 2.2 | 9.8 ± 2.5** | 4.0 ± 2.1** | |
Diazepam group | 5.3 ± 3.5 | 10.6 ± 4.8** | 4.3 ± 1.2** | |
WDD group | 6.8 ± 3.7 | 11.4 ± 2.5** | 2.0 ± 0.9*▲ |
Serum levels of orexin-A in the model group were significantly higher than those in the control group (
In both prefrontal cortex and hypothalamus, orexin-A and leptin expressions in the model group were significantly lower than those in the control group (
The effect of sleep deprivation on the mean integrated optical density (MOD) of orexin-A and leptin in the prefrontal cortex and hypothalamus and the regulation of WDD.
Part | Groups | Orexin-A | Leptin |
---|---|---|---|
Prefrontal cortex | Control group | 0.17 ± 0.03 | 0.40 ± 0.02 |
Model group | 0.14 ± 0.02** | 0.19 ± 0.04** | |
Diazepam group | 0.14 ± 0.01** | 0.22 ± 0.03**▲ | |
Wen-dan group | 0.16 ± 0.01▲▲** | 0.27 ± 0.03**▲▲ | |
|
|||
Hypothalamus | Control group | 0.17 ± 0.01 | 0.27 ± 0.03 |
Model group | 0.12 ± 0.02** | 0.15 ± 0.04** | |
Diazepam group | 0.13 ± 0.02** | 0.18 ± 0.03**▲▲ | |
Wen-dan group | 0.14 ± 0.01**▲▲★ | 0.21 ± 0.02**▲▲★★ |
Protein expression of orexin-A in prefrontal cortex. (Tissue sections were viewed at
Control group
Model group
Diazepam group
WDD group
Protein expression of orexin-A in hypothalamus. (Tissue sections were viewed at
Control group
Model group
Diazepam group
WDD group
Protein expression of leptin in prefrontal cortex. (Tissue sections were viewed at
Control group
Model group
Diazepam group
WDD group
Protein expression of leptin in hypothalamus. (Tissue sections were viewed at
Control group
Model group
Diazepam group
WDD group
The effect of sleep deprivation on orexin-A concentrations in serum and the regulation of Wen-Dan Decoction. **
The effect of sleep deprivation on leptin serum concentrations and the regulation of Wen-Dan Decoction. **
Table
The effect of sleep deprivation on mRNA expression of orexin-A, OX1R, and Ob-R in prefrontal cortex and hypothalamus and the regulation of WDD.
Part | Group | Orexin-A | OX1R | OB-R |
---|---|---|---|---|
Prefrontal cortex | Control group | 1.62 ± 0.54 | 0.80 ± 0.34 | 1.10 ± 0.10 |
Model group | 0.70 ± 0.20 | 0.34 ± 0.14 | 0.61 ± 0.13** | |
Diazepam group | 1.65 ± 0.22▲▲ | 0.64 ± 0.11▲ | 1.91 ± 0.07**▲▲ | |
Wen-dan group | 2.15 ± 0.04▲▲★ | 0.79 ± 0.10▲ | 0.79 ± 0.07*★★ | |
|
||||
Hypothalamus | Control group | 2.41 ± 1.41 | 0.82 ± 0.23 | 1.28 ± 0.45 |
Model group | 1.91 ± 1.01 | 0.99 ± 0.04 | 2.55 ± 0.23** | |
Diazepam group | 1.22 ± 0.34 | 0.78 ± 0.26 | 2.71 ± 0.24**▲ | |
Wen-dan group | 2.09 ± 0.17 | 1.65 ± 0.74 | 4.30 ± 0.76*▲★ |
The present study showed that SD significantly increased Cm and Rm time in rats in the open field, while WDD treatment reversed these changes. Especially, at 14 days after SD, the Rm time in the WDD-treated group was significantly lower than that in the diazepam-treated group (
After long-term SD, significantly decreased protein expression of orexin-A was observed in prefrontal cortex and hypothalamus, but mRNA expression of orexin-A in prefrontal cortex and hypothalamus of the model group was lower than the control group, though this latter difference did not reach statistical significance. A previous study [
As mentioned above, WDD is a famous Chinese medicine that has been prescribed for hundreds of years and that has a remarkable effect in the treatment of insomnia.
It is read that “Ban xia, Zhu ru, Zhi shi 2
Results from the present study show that the excitability behavior of rats is enhanced on day 14 after SD. Improvements were observed after both WDD and diazepam treatments, and WDD effects were superior to those of diazepam. WDD does not function as a sedative-hypnotic; rather, WDD regulates the emotional disorders caused by insomnia, thus improving sleep quality. The observed enhanced excitability caused by SD in our study is in accordance with other researchers’ findings [
In conclusion, the present study demonstrated that SD is a good model to induce insomnia-related negative emotions. WDD treatment effectively improved SD-induced negative emotions by regulating the function of orexin-A and leptin, such as the upregulated orexin-A and leptin in blood serum and brain tissue of SD rats compared to control animals. Furthermore, our study demonstrated that WDD can upregulate orexin-A, OX1R, and Ob-R in the prefrontal cortex of the SD rats, while only upregulating Ob-R in hypothalamus. WDD treatment has been proven effective in improving SD-induced negative emotions by regulating orexin-A and leptin, an effect that may have a great impact on the treatment of patients with insomnia.
The authors declare that there is no conflict of interests regarding the publication of this paper.
Fengzhi Wu, Yuehan Song, and Feng Li were equal contributors to this paper.
This research was supported by the 111 Project (B07007), the National Natural Science Youth Foundation of China (81001501), and the key discipline of Beijing University of Chinese Medicine (Nautical Traditional Chinese Medicine) (522/0100604054). Cai Song was supported by the China Education Ministry “Overseas Famous Professor” Program.