Xueshuan Xinmaining Tablet (XXT), the Chinese formula, has long been administered in clinical practice for the treatment of cerebral thrombosis and coronary heart disease. In this study, we aimed to study the effect and the molecular mechanism of activating blood circulation and removing blood stasis. Rat models of cold coagulation blood stasis were induced with ice-water bath and epinephrine to assess the amelioration of blood stasis by XXT. Microarray technique was used to identify gene expression from the model and XXT-treated rats. In addition, Quantitative Real-Time PCR (qPCR) was performed to verify the microarray results. The results showed that XXT had a good therapeutic effect on blood stasis by reducing the whole blood viscosity (WBV), plasma viscosity (PV), increasing PT, APTT and TT, and by inhibiting platelet aggregation. Genes were differentially expressed in rats among the model group and the XXT-pretreated groups. XXT ameliorated blood stasis by regulating the expressions of F13a1, Car1, and Tbxa2r.
Traditional Chinese medicine (TCM), guided by the theory of traditional Chinese medical science, has been used for over 5,000 years mainly in China and other Asian countries. According to the Chinese medicine theory, body’s normal function can be restored by obtaining the balance of
The extract of Xueshuan Xinmaining Tablet (XXT) was provided by Jilin Huakang Pharmaceutical Co., Ltd. Raw materials were purchased from Guanxian (Sichuan), Zhongjiang (Sichuan), Jilin (Jilin), Luoyang (Henan), Tonghua (Jilin), Wenshan (Yunnan), Shijiazhuang (Hebei), Fusong (Jilin), Meishan (Sichuan), and Zhenjiang (Jiangsu), respectively. All of them were authenticated and verified according to the Chinese pharmacopoeia (2010). The voucher specimens (no. HKYY-20130916-20130925) were deposited in the New Drug Research and Development Laboratory of Jilin University. And the preparation method was described as follows:
Some standard compounds were also used in this study. Rutin (Lot number: 100080-200707), ferulic acid (110773-200611), salvianolic acid B (111562-200908), Ginsenoside Rg1 (110703-200726), Ginsenoside Re (110754-200822), Ginsenoside Rb2 (111715-201203), Ginsenoside Rb3 (111686-201203), Ginsenoside Rd (111818-201302), Cryptotanshinone (110852-200806), cholic acid (10078-0013), Cinobufagin (110803-200605), Resibufogenin (0718-9004), and Tanshinone IIA (0766-200011) were purchased from the National Institutes for Food and Drug Control (Beijing, China). Ginsenoside Rc was provided by the New Drug Research and Development Laboratory of Jilin University.
The fingerprints of the XXT extract were further analyzed with a high performance liquid chromatography (HPLC) system (Waters, USA) that consisted of a model 1525 Waters pump, model SEDEX FRANCE 75 Evaporative Light-scattering Detector, and Diamonsil C18 Column (5
The fingerprints of the mixed standard compounds.
The fingerprints of extract of XXT. (1) Rutin; (2) salvianolic acid B; (3) Ginsenoside Rg1; (4) Ginsenoside Re; (5) Ginsenoside Rc; (6) Ginsenoside Rb2; (7) Ginsenoside Rb3; (8) Ginsenoside Rd; (9) Cryptotanshinone; (10) cholic acid; (11) Cinobufagin; (12) Resibufogenin; (13) Tanshinone IIA.
Buchang Naoxintong (BN) capsule, produced by Shaanxi Buchang Pharmaceutical Co., Ltd., is another traditional Chinese medicine. It has been approved for the treatment of cerebrovascular and cardiovascular diseases for many years [
Male Wistar rats weighing 180–220 grams (Animal Center of Norman Bethune Medical College of Jilin University, Jilin, China) were purchased one week before the experiment and were habituated to the living and testing environments. The rats were kept under controlled environmental conditions (22
The experimental groups (
To evaluate the success of the BSS model in rats, the hemorheology and coagulation function indexes and platelet aggregation were assessed in this study. The hemorheology indexes of whole blood viscosity and plasma viscosity, the coagulation function index of thrombin time (TT), activated partial thromboplastin time (APTT), prothrombin time (PT) and fibrinogen (FIB), and platelet aggregation were measured according to a previously described method [
Rats were anesthetized with 10% chloral hydrate (3 mL/kg) at 17 h at the 8th day after the last injection of epinephrine [
The coagulation function index included thrombin time (TT), activated partial thromboplastin time (APTT), prothrombin time (PT), and fibrinogen (FIB). It was determined by coagulometer (Model LG-PABER-I, Steellex Co., China) with commercial kits, according to the manufacturers’ instructions. To establish the standard curve of TT and thrombin concentration, TT was determined by incubating 60
Platelet-rich plasma was obtained after centrifugation of citrated whole blood at 200 g for 15 min, and then platelet-poor plasma was obtained by centrifugation at 2000 g for another 15 min [
All quantitative data were given as means ± SD performed using the SPSS 11.5 software package for Windows. Multiple comparisons among groups were performed by one-way analyses of variance (ANOVA). Student’s
Total RNA was extracted from the rat whole blood of each group using Trizol (Invitrogen, Gaithersburg, MD, USA) reagent. Then RNA was concentrated by isopropanol and was purified using the NucleoSpin RNA Clean-up kit (MACHEREY-NAGEL, Germany) following the manufacturer’s protocol. RNA concentration was then determined using Epoch (Bio Tek, Winooski, USA) with A260/A280 ratio between 1.8 and 2.0 and the RNA concentration was adjusted to 1
The quality of RNA was checked using the Epoch microvolume spectrophotometer system and formaldehyde modified gel electrophoresis. Only high quality RNA (RNA Integrity Number (RIN) > 9.0) was used for microarray experiments. The rat genome oligonucleotide set was generated using 27K Rat Genome Array (CapitalBio’s prespotted high-density pairwise oligonucleotide microarrays, version 3.0 CapitalBio Corp., Beijing, China). Each 27K Rat Genome Array consisted of 26,962 amino acid modified 70-mer probes that represented 22,012 genes and 27,044 transcripts. The cRNA synthesis and labeling were carried out following GeeDomc RNA amplification tag protocol. Total RNA from each sample, along with poly A spikes (labeling control), was converted to double-stranded cDNA. Biotinylated cRNA was synthesized by
Raw microarray data were first normalized and the bad spots (misprinted spots) were discarded. Genes with signal intensity (Cy3 or Cy5) over 800 were regarded as the expressed ones. Significant changes in gene expression (
Three genes (>2-fold change) that had antithrombotic function were verified by qPCR technique. PrimeScript RT Master Mix (Takara, Beijing, China) was used to obtain the cDNA. qPCR was performed according to the instructions of SYBR
The primer pairs for the real time PCR.
No. | Gene | Primer sequence | Length (bp) | GC% |
---|---|---|---|---|
1 | F13a1-F | CCGAATGCATCGTGGGGAAA | 20 | 55% |
F13a1-R | ACACAGCGTCTTCTTCGCAC | 20 | 55% | |
|
||||
2 | Car1-F | CAACCAGTCAGTGCTGAAAG | 20 | 50% |
Car1-R | GAACTAAGTGAAGCTCTCCAG | 21 | 47.6% | |
|
||||
3 | Tbxa2r-F | TGGATGCCCTTGCTGGTCTT | 20 | 55% |
Tbxa2r-R | CGTAGGTAGATGAGCAGTTG | 20 | 50% |
The effects of XXT with different dosages on WBV and PV are shown in Table
Effect of XXT on the whole blood viscosity (WBV) and plasma viscosity (PV) in blood stasis rats (
Group | Dose (mg/kg) | WBV (mPa/s) |
PV (mPa/s) | ||
---|---|---|---|---|---|
20/s | 60/s | 150/s | |||
NC | — | 9.81 ± 0.45** | 5.55 ± 0.27** | 3.76 ± 0.17* | 0.86 ± 0.05** |
|
|||||
Model | — | 10.45 ± 0.39 | 6.00 ± 0.30 | 4.07 ± 0.22 | 1.22 ± 0.18 |
|
|||||
XXT | 350 | 10.18 ± 0.54 | 5.83 ± 0.34 | 3.87 ± 0.18* | 0.93 ± 0.04** |
700 | 9.39 ± 0.63** | 5.33 ± 0.42** | 3.61 ± 0.28** | 0.83 ± 0.06** | |
1400 | 9.56 ± 0.44** | 5.44 ± 0.23** | 3.75 ± 0.13** | 0.85 ± 0.10** | |
|
|||||
BCN | 800 | 9.65 ± 0.57** | 5.55 ± 0.47* | 3.79 ± 0.33* | 0.86 ± 0.11** |
The effects of XXT on blood coagulation were evaluated by assays of APTT, PT, TT, and FIB content in the plasma. The level of FIB was increased, APTT and TT were shortened, and PT was significantly decreased in the model rats. The levels of PT, APTT, and TT were increased by XXT (700, 1400 mg/kg) and BCN treatment (
Effect of XXT on the plasma coagulation parameters and platelet aggregation rate in rats (
Group | Dose (mg/kg) | Plasma coagulation parameters | Platelet aggregation rate (%) | |||
APTT (s) | PT (INR) | TT (s) | FIB (g/L) | |||
|
||||||
NC | — | 21.98 ± 3.44** | 1.40 ± 0.11* | 27.42 ± 2.47** | 1.99 ± 0.13** | 22.89 ± 5.07** |
|
||||||
Model | — | 16.58 ± 1.61 | 1.29 ± 0.08 | 23.68 ± 2.64 | 4.69 ± 0.40 | 35.72 ± 3.39 |
|
||||||
XXT | 350 | 16.94 ± 2.48 | 1.35 ± 0.09 | 23.56 ± 2.47 | 4.57 ± 0.38 | 31.84 ± 5.45 |
700 | 18.31 ± 2.00* | 1.39 ± 0.18 | 27.06 ± 3.35* | 4.71 ± 0.42 | 31.06 ± 3.92* | |
1400 | 19.52 ± 3.63* | 1.45 ± 0.23* | 27.88 ± 3.26** | 4.54 ± 0.31 | 28.25 ± 5.42** | |
|
||||||
BCN | 800 | 19.03 ± 3.16* | 1.37 ± 0.11 | 26.50 ± 3.07* | 4.68 ± 0.35 | 29.65 ± 5.50** |
Platelet aggregation rate in the model group was significantly increased. As shown in Table
Data fluctuation by over 2.0-fold was considered to be differential expression. After blood stasis modeling, 435 genes were detected with significant change as compared to the normal control, of which 373 (approximately 85.75%) were upregulated. However, 501 differentially expressed genes, of which 307 genes were upregulated, were detected in the XXT group.
We then conducted hierarchical clustering of the differentially expressed genes (Figure
Hierarchical clustering of the differentially expressed genes. Red color indicates a minimum of two fold’s increase in expression; green represents a minimum of twofold’s reduction in expression. In the left column, two cluster arrays indicate gene expression from the model group versus the normal control (NC) group, and in the right column, the XXT versus model group.
Perl analysis was performed for the gene patterns changed by XXT. 13 overexpressed genes in the blood stasis model were downregulated by XXT, and 3 lower-expressed genes were upregulated by XXT (Table
Information of the genes that change their expression pattern by XXT.
No. | Gene no. | M versus N | XXT versus M | Gene name/description |
---|---|---|---|---|
1 | Rn30003360 | 7.07645 |
0.38265 |
—/electron transporter activity |
2 | Rn30006822 | 4.32535 |
0.35525 |
—/— |
3 | Rn30004649 | 65.10415 |
0.4483 |
—/— |
4 | Rn30000949 | 2.54515 | 0.2371 | —/RGD1563482 |
5 | Rn30018583 | 2.45385 |
0.28735 |
—/runt related transcription factor 2 |
6 | Rn30020887 | 5.67375 |
0.35665 |
Fam58b/— |
7 | Rn30002724 | 6.4456 |
0.21045 |
—/— |
8 | Rn30006927 | 25.1743 |
0.42055 |
Dnm2/L25605 |
9 | Rn30006808 | 4.8359 |
0.2197 |
Smtnl1/XM_230278 |
10 | Rn30000910 | 2.18855 |
0.35985 |
—/postmeiotic segregation increased 2 |
11 | Rn30022682 | 2.98935 | 0.24595 | —/similar to RBT1 |
12 | Rn30004786 | 27.18685 | 0.29585 | —/idine phosphorylase 2 |
13 | R003120_01 | 2.6854 |
0.20565 |
Slc7a5/tumor-associated protein 1 |
14 | Rn30019843 | 0.3703 |
3.41815 |
RGD1564417/similar to tumor protein D53 |
15 | Rn30007627 | 0.23865 |
3.08495 |
Prg2/proteoglycan 2, bone marrow |
16 | Rn30014233 | 0.2301 |
3.67895 |
Cdca3/ell division cycle associated 3 |
The magnitude and direction of changes in expression of the three genes affected by XXT pretreatment were confirmed by qPCR (Figure
The mRNA expressions of F13a1, Car1, and Tbxa2r.
Recently, blood stasis syndrome (BSS) is attached to the theory of promoting blood circulation and removing blood stasis (PBCRBS) by scholars in various countries [
Results of microarray technology showed that a multitude of genes was differently expressed in acute blood stasis model rats. These genes, such as gene thrombin receptor-like 2 (F2rl2) and blood coagulation factor XIV (Proc), represent coagulant functions, which are vital in the blood coagulation [
Investigating functional mechanism of complex TCM is a challenging task. In this study, the hemorheological and microarray experiments were conducted to explore the anti-blood stasis effect and related mechanism of XXT. The results demonstrated that XXT could significantly reduce the whole blood viscosity, plasma viscosity, increase PT, APTT, and TT, and inhibit platelet aggregation. Moreover, we also found that peripheral blood mRNA expression was dramatically changed in blood stasis model rats. And prophylactic administration XXT could prevent the abnormal expression of genes.
The authors declare that there is no conflict of interests regarding the publication of this paper.
This work was supported by grants from the China Postdoctoral Science Foundation (Grant no. 2012M511348) and from the Jilin Province Science & Technology Development Project (Grant no. 201205014).