Neuroinflammation is considered as one of the common pathogeneses of depression. Huanglian-Jie-Du-Tang (HJDT) is a traditional Chinese herbal formula. The present study investigates the antidepressant-like effect of HJDT and its possible mechanism in rats. Rats were given HJDT (2, 4, and 8 g/kg, intragastrically), paroxetine (1.8 mg/kg, intragastrically), or an equivalent volume of saline for 42 days. The depression-related behaviors, including sucrose preference test (SPT), open field test (OFT), novel objective recognition task (NORT), and forced swimming test (FST), were detected. 5-Hydroxytryptamine (5-HT) and dopamine (DA) contents, microglial activation, proinflammatory cytokines, and brain derived neurotrophic factor (BDNF), tropomyosin receptor kinases B (TrkB), and cAMP-responsive element binding protein (CREB) expression were investigated. The results indicated HJDT (2 and 4 g/kg) dramatically ameliorated the depression-like behaviors. Also HJDT decreased the number of microglia and the proinflammatory cytokines in hippocampus. Western-blotting analysis displayed HJDT upregulated BDNF, TrkB, and pCREB/CREB expression in hippocampus. Particularly, pCREB DNA activity enhanced with HJDT treatment in hippocampus. But there was no difference in the 5-HT and DA contents with HJDT treatment. In conclusion, it was supposed that HJDT might be a potential Chinese medicine decoction for treating or alleviating complex symptoms of depression through BDNF-TrkB-CREB pathway.
Depression is a serious mental disorder with a high prevalence worldwide and causes serious consequences for the individual’s quality of life [
Huanglian-Jie-Du-Tang (HJDT) is a traditional Chinese herbal formula composed of the roots of
Microglia are important resident immunoreactive cells in the central nervous system (CNS). Commonly, microglia were considered to be “resting,” becoming “activated” upon allostatic changes to coordinate immune-like responses [
The roots of
The HPLC was carried out as described in our previous study [
Male Sprague-Dawley rats (Shanghai Slyke Laboratory Animal Limited Corporation, Certificate number SCXK 2012-0002, China) were handled in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals and the norms of the Ethics Committee for Animal Research of Hangzhou Medical College. They were housed under a 12 : 12 h light/dark cycle, controlled temperature of
After environmental adaption for one week, the rats were assigned to one of the following groups according to their sucrose preference ratio and body weight: normal control group (only saline treatment and no chronic unpredictable stress (CUS)); CUS depression group (saline treatment and CUS); paroxetine group (1.8 mg/kg, GlaxoSmithKline, England, paroxetine treatment group and CUS); HJDT groups (2, 4, and 8 g/kg, HJDT treatment and CUS). Rats were given intragastrically either paroxetine, HJDT, or saline for 42 days after the CUS, and at 1 h before the beginning of the CUS procedure or behavioral tests. The dose of paroxetine and HJDT were chosen based on the previous reports [
Except normal control group, rats in other groups were subjected to two stressors on an unpredictable order and at an unpredictable time each day following gavage for 6 weeks. The stresses included food deprivation for 24 h, water deprivation for 24 h, inversion of day/night cycle, forced swimming for 6 min, 45° tilted cage for 7 h, soiled cage bedding overnight, and restraint for 5 min. Rats in normal control group were left undisturbed during the period. The body weight was measured once weekly from day 0 after the CUS. Sucrose preference test (SPT), open field test (OFT), novel objective recognition task (NORT), and forced swimming test (FST) were performed from day 42 to day 48 after the CUS, respectively (see Figure
Schedule of the experimental protocol.
The SPT was carried out as previous report with slight modification [
Each rat was placed gently into the center of a brightly lit open field arena (80 × 80 × 40 cm). The locomotor tracks were continuously recorded by a video camera for 5 min and analyzed by a computerized video tracking system (EthoVision XT, Noldus, Netherlands). The following parameters were determined: (a) total traveled distance (m), (b) time in central region (s), (c) traveled central distance ratio, and (d) rearing number. After each test session, the enclosures were thoroughly cleaned with 70% ethanol solution.
The task consisted of three phases: T1 phase, interval time, and T2 phase. During habituation, rats were introduced in the empty chamber and left to freely explore it for 10 min. Afterwards, they were put into their home cages for 5 min, during which two identical objects (familiar object: cubic crude wood with 4 cm diameter) were placed in the chamber oppositely. In the T1 phase, rats explored the objects for 5 min. After a 1.5 h interval time, rats were placed into the chamber again for 5 min, when one of the familiar objects was replaced by a novel one (novel object: cylindrical crude wood with 4 cm diameter and height), that is, T2 phase. Tracks were recorded and analyzed by a computerized video analyzer (EthoVision XT, Noldus, Netherlands). The following parameters were analyzed: total exploration time to familiar and novel objects, discrimination ratio (DR, DR = [
One day before proceeding for the test, rats were trained for swimming for 15 min in a glass cylinder (60 cm height × 25 cm diameter) filled with water at 30 cm height and under temperature
Rats were decapitated and the hippocampus was separated on ice quickly at day 49 after the CUS. Then it was sonicated to obtain tissue homogenates. After removing particulars by centrifugation (2000 ×g, 4°C, 20 min), assay was immediately detected. 5-HT (number EIA-3325) and DA (number EIA-3236) were measured using respective ELISA system (Shanghai ELISA Biotech Co., Ltd, China) according to the manufacturer’s instructions. Finally, optical density was determined (absorbance at 450 nm) on a plate reader.
Rats were anesthetized after the behavioral tests at day 49. To investigate the activation and the number of microglia in the hippocampal CA1 region and DG, immunohistochemical methods were performed with the polyclonal rabbit antibodies against Iba-1 (1 : 200, Wako, Japan, number 019-19741). The brain cryosections preparation and immunohistochemical methods were based on our previous report (Ye et al., 2016). Normal goat serum was used instead of the primary antibody in the control sections. The number of positive cells in the hippocampal CA1 region and DG was calculated with three different fields.
Total RNA was extracted from hippocampus using Trizol reagent (Invitrogen Life Technologies, USA). For cDNA synthesis, 1.5
TNF-
F: 5′CTGGCGTGTTCATCCGTTCT3′
R: 5′GCCACTACTTCAGCGTCTCGT3′
iNOS
F: 5′TTGGAGCGAGTTGTGGATTG3′
R: 5′TGAGGGCTTGCCTGAGTGA3′
IL-1
F: 5′CCTCTGACAGGCAACCACTTA3′
R: 5′GCACTGGTCCAAATTCAATTC3′
IL-6
F: 5′TGCCTTCTTGGGACTGATGT3′
R: 5′ATACTGGTCTGTTGTGGGTGGT3′
IL-10
F: 5′TTGAACCACCCGGCATCTAC3′
R: 5′CCAAGGAGTTGCTCCCGTTA3′
GAPDH
F: 5′GGAAAGCTGTGGCGTGAT3′
R: 5′AAGGTGGAAGAATGGGAGTT3′
The products of RT-PCR were separated by electrophoresis using 1.2% agarose gel and stained with ethidium bromide. Densitometric analysis was performed using image analysis software.
Samples of hippocampus were homogenized on ice in PBS containing 1% protease inhibitor and 1% phosphatase inhibitor for Western-blotting. Proteins were obtained by centrifugation at 14000 rpm at 4°C for 15 min and quantified by Bradford assay (BioRad, USA). A 50
The TransAM assay for pCREB activity (Active Motif, USA, number 42096) was performed according to the manufacturer’s instructions. Briefly, oligonucleotides containing the pCREB consensus binding site were immobilized on a 96-well plate. The active forms of pCREB in the nuclear extracts were bound to the oligonucleotides on the plate and detected colorimetrically. The samples were measured at an absorbance of 450 nm on a spectrophotometer.
All of the data were expressed as mean ± SEM. Repeated measures of one-way analysis of variance tests (ANOVA) and Fisher’s least significant differences (LSD) post hoc analysis tests were performed to analyze the significance of any treatment effect among the groups by SPPS 16.0 for Windows except the effects of HJDT on NORT.
Using HPLC, we detected the contents of 7 active components in the decoction of HJDT (Table
Contents of active components in the decoction of HJDT (%)
Geniposide | Baicalin | Palmatine hydrochloride | Berberine hydrochloride | Wogonoside | Baicalein | Wogonin | |
---|---|---|---|---|---|---|---|
Content (%) |
|
|
|
|
|
|
|
|
|||||||
|
5 | 5 | 5 | 5 | 5 | 5 | 5 |
As shown in Figure
Effects of HJDT on the body weight after the CUS in rats. The body weight of rats in CUS depression group decreased from day 7 to day 42 after the CUS. Paroxetine group gained the body weight from day 35 after the CUS. HJDT had no effect on the body weight decrease after the CUS.
Prior to the onset of CUS, all experimental groups showed similar sucrose consumption ratio (data not shown). But at day 43 after the CUS, CUS depression group showed a significant decrease of sucrose consumption ratio, compared with the normal control group (Figure
The effect of HJDT on the sucrose consumption ratio in SPT after the CUS. The sucrose consumption ratio decreased in the CUS depression group. Treatment with paroxetine and HJDT (2, 4 g/kg) increased the sucrose consumption ratio.
After the CUS, the total traveled distance in experimental groups, exposed to the CUS, decreased in OFT as compared with the normal control group (Figure
Effects of HJDT on the locomotor activity in OFT after the CUS. Traveled total distance decreased in all rats when exposed to CUS (a). The rearing number decreased in CUS depression group and was reversed with paroxetine and HJDT 2 g/kg treatment (b). The central time and central distance ratio both decreased in CUS depression group and reversed with paroxetine and HJDT (2, 4 g/kg) treatment (c, d).
As shown in Figure
Effects of HJDT on the exploration time, DR, and DI in NORT after the CUS. The exploration time to novel object increased compared with familiar object in T2 phase in normal control group, paroxetine group, and HJDT (2, 4 g/kg) groups (a). DR (b) and DI (c) in T2 phase significantly increased in normal control group, paroxetine group, and HJDT (2, 4 g/kg) groups compared to T1 phase.
The immobility time increased in the CUS depression group compared with the normal control group (Figure
Effect of HJDT on the immobility time in FST after the CUS. The immobility time increased in CUS depression group and was reversed after treatment with paroxetine and HJDT (2, 4 g/kg).
Iba-1 positive cell represents the activated microglia. The results of immunohistochemistry detection revealed the morphological and number change of microglia (Figure
Effect of HJDT on the microglia morphology and number in the hippocampal CA1 region and DG after the CUS. The representative morphology and the number change of microglia in all groups (a). The number of Iba-1 positive cells in hippocampal CA1 region increased in CUS depression group and was reversed with paroxetine and HJDT (2, 4 g/kg) treatments (b). The number of Iba-1 positive cells in hippocampus DG increased in CUS depression group and was reversed with paroxetine and HJDT 2 g/kg treatment (c).
BDNF, TrkB, CREB, and pCREB protein expression was detected by Western-blotting method (Figure
Effect of HJDT on the BDNF, TrkB, and pCREB/CREB expression in the hippocampus after the CUS. The expression of BDNF (a), TrkB (b), and pCREB/CREB (c) decreased in the CUS depression group and was reversed with paroxetine and HJDT (2, 4 g/kg) treatment. Protein expression is induced by CUS and drug treatment in the hippocampus (d).
The pCREB OD593 value in the normal control group was
Effect of HJDT on the pCREB DNA activity in the hippocampus after the CUS. The pCREB DNA activity decreased in the hippocampus and was reversed with HJDT (2, 4 g/kg) treatment and there was no effect with paroxetine treatment.
The results of RT-PCR showed that CUS depression model was related with inflammation reaction. The mRNA of proinflammatory cytokines, IL-1
Effect of HJDT on proinflammatory and anti-inflammatory cytokines mRNA in the hippocampus after the CUS. The effects of HJDT on the iNOS mRNA (a), IL-6/IL-10 mRNA ratio (b), IL-1
The results of ELISA showed the contents of 5-HT and DA both decreased in the CUS depression group when compared with the normal control group. Treatment with paroxetine reversed the decrease of 5-HT content (Figure
Effect of HJDT on the 5-HT and DA contents in the hippocampus after the CUS. The contents of 5-HT (a) and DA (b) decreased in CUS depression group. Paroxetine treatment only increased the 5-HT content (a) and there was no effect on DA content (b) in the hippocampus. There was no effect of HJDT on the contents of 5-HT and DA in the hippocampus (a, b).
The present study was aimed at examining the depression-like response following administration of aqueous extract of HJDT in rats which were subjected to the CUS. The major findings of this study include the fact that administration of HJDT during the CUS ameliorated depression-like behaviors, like anhedonia, decreased locomotor activity, despair condition, and cognitive function deficit, which could be relative to the inhibition of microglia activation, following with inflammation reaction inhibition and BDNF-TrkB-CREB pathway upregulation.
The stress-induced body weight decrease is an accompanying symptom of depression. However, HJDT did not gain the body weight decrease in CUS-treated rats except paroxetine treatment from day 35 to day 42 after the CUS, which is consistent with the previous findings about Traditional Chinese Medicine (TCM) treatment [
The classic opinion on the development of depression considered that it was related to the monoamine neurotransmitter and serotonin (5-HT) system dysfunction [
Neuroinflammation is considered as one of the common pathogeneses of depression in recent research. The activation of the inflammatory immune system may induce the decrease of neurons regeneration and neurotrophic factors release and enhancement of the neuroinflammation reaction [
In addition, activation of microglia can provoke the dysregulation of several growth factors in depression, like BDNF. BDNF and CREB had been reported to involve neuronal differentiation and survival as well as the synaptic plasticity associated with learning and memory in various nervous system disorders, including depression [
In summary, the present study supports the notion that microglial activation, followed by inflammation reaction and BDNF decreasing, may contribute to the depressive-like behavior in a rat model in response to the CUS. HJDT treatment potentially ameliorated the depression-like behaviors. Additionally the research indicated that the effects of HJDT might be related to the decrease of microglia number, following with the reduction of inflammatory cytokines and the promotion of BDNF-TrkB-CREB pathway, which was independent of the HT and DA contents change. This antidepressant effect of HJDT was probably related to the synergistic effect of each active component, including berberine, baicalin, wogonoside, and gardenoside [
No conflict of financial interests exists.
This work was supported by grants from the Scientific Foundation in TCM of Zhejiang Province (2013ZB028) and the Foundation of Science Technology Department of Zhejiang Province (2016C37099). The authors acknowledge GlaxoSmithKline, England, for providing paroxetine.