Defective tissue repair and remodeling are main aspects of Chronic Obstructive Pulmonary Disease (COPD) pathophysiology. Bone marrow mesenchymal stem cells (BM-MSCs) have been implicated in this direction, as their functional impairment and recruitment could possibly contribute to disease development and progression. The present study characterizes for the first time the expression of migration related chemokine receptors and their ligands in BM-MSCs from COPD patients. CXCR4/SDF1a and CCR7/CCL19-CCL21 mRNA levels were evaluated in BM-MSCs obtained from twelve COPD patients and seven healthy donors. SDF1a protein levels in sera and BM-MSCs’ conditioned media were also evaluated. CXCR4, SDF1a, CCL19, and CCL21 mRNA levels were significantly reduced in COPD BM-MSCs while CCR7 levels were undetectable. Notably, SDF1a protein levels were marginally elevated in both patient sera and BM-MSCs’ conditioned media while the increase in SDF1a serum levels significantly correlated with disease severity in COPD. Our findings show posttranscriptional regulation of SDF1a levels in BM-MSCs of COPD patients and significant downregulation of SDF1a and CXCR4 mRNA indicating an involvement of the SDF1a signaling pathway in the disease pathophysiology.
Chronic Obstructive Pulmonary Disease (COPD) is defined as a “common preventable and treatable disease characterized by persistent airflow limitation that is usually progressive and associated with an enhanced chronic inflammatory response in the airways and the lung to noxious particles or gases.” Exacerbations and comorbidities contribute to the overall severity in individual patients [
Mesenchymal stem (stromal) cells (MSCs) are multipotent stromal cells that can be isolated from bone marrow, skeletal muscle, amniotic fluid, and adipose tissue, among others tissues. They are plastic adherent cells with a differentiation potential towards adipocytes, chondrocytes, and osteoblasts [
The aim of the current study is to investigate the possible involvement of BM-MSCs in the pathophysiology of COPD by evaluating the expression of genes involved in proliferation/migration process, namely, the CXCL12a/CXCR4 and CCR7/CCL19, CCL21 ligand/receptor dyad.
This study was conducted in accordance with the amended Declaration of Helsinki. The Research Ethics Committee of the University of Crete approved the study protocol and written informed consent was obtained from the 19 subjects before entering the study (Decision 412, 18/06/2014 protocol number 14724). Of these, the 12 participants diagnosed as having COPD, according to the GOLD guidelines, were current or ex-smokers who had at least a 20-pack-year smoking history and had an FEV1/FVC ratio of <70% and reversibility to an inhaled beta-2 agonist of <10% or <200 mls absolute improvement [
Lung function testing, including spirometry with a bronchodilation test and DLCO measurement, was performed by all participants with a computerized system (MasterLab; 2.12, Jaeger, Wuerzburg, Germany) according to standardized guidelines.
Peripheral blood samples and serum were obtained from all participants and were stored at −80°C, after appropriate preparation, according to standard procedures.
BM-MSCs were obtained from posterior iliac crest aspirates and cultured in vitro as previously described [
BM-MSCs from second passage (P2) were immunophenotypically characterized by flow cytometry using anti-human monoclonal antibodies against anti-CD73 (AD2; Becton Dickinson-Pharmingen, San Diego, CA), anti-CDw90 (F15.42; Immunotech/Coulter), anti-CD105 (SN6; Caltag, Burlingame, CA), anti-CD45 (IMMU19.2; Immunotech/Coulter), anti-CD14 (IM2580U; Beckman-Coulter), and antiCD34 (QBend10; Beckman-Coulter). Data were processed in an Epics Elite flow cytometer (Coulter, Miami, FL).
BM-MSCs at P2 were homogenized in TRIzol reagent (Invitrogen, Carlsbad, CA), total RNA was extracted, and cDNA was synthesized by reverse transcription (RT) with the Thermoscript RT kit (Invitrogen). mRNA expression was measured using a real-time RT-PCR assay with SYBR-Green I. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control, in order to normalize SDF-1a, CXCR4, CCR7, CCL19, and CCL21 expression levels. Relative expression levels per sample were calculated as
Primer sequences used for real-time RT-PCR.
Gene | Primer sequence (5′-3′) | Annealing temperature | |
---|---|---|---|
CXCR4 | FOR | GGTGGTCTATGTTGGCGTCT | 55°C |
REV | TGGAGTGTGACAGCTTGGAG | ||
SDF1a | FOR | TGAGAGCTCGCTTTGAGTGA | 55°C |
REV | CACCAGGACCTTCTGTGGAT | ||
CCR7 | FOR | GGTGGTGGCTCTCCTTGTCATTTT | 55°C |
REV | AGTTCCGCACGTCCTTCTT | ||
CCL19 | FOR | GGACTTCCCCAGCCCCAACTCT | 62°C |
REV | TAACTGCTGCGGCGCTTCATCTT | ||
CCL21 | FOR | CCTCAGCTCTGGCCTCTTAC | 57°C |
REV | GGGGCAAGAACAGGATAGCTG | ||
GAPDH | FOR | AGCCACATCGCTCAGACA | 53°C |
REV | CCAATACGACCAAATCCGTT |
SDF-1a levels in MSC conditioned media at P2 and sera were evaluated by means of ELISA (Quantikine; R&D Systems, Minn., MN).
Results were analyzed using IBM SPSS statistics v21.0. Nonparametric Mann–Whitney statistical test was used and values were expressed as medians (interquartile range). Spearman’s rank coefficient (rho) was used to evaluate correlations between severity of the disease (FEV1% pred) and chemokines expression. A value of
Table
Patient’s demographic data.
COPD patients ( |
Controls ( |
|
|
---|---|---|---|
Age (years) | 65.5 (55.3–72) | 58 (33–63) | NS |
Gender (m/f) | 11/1 | 6/1 | NS |
BMI | 30.1 (259–31.8) | 27.8 (25.5–31.1) | NS |
Smoking status (c/ex) | 7/5 | 6/1 | NS |
PY | 53 (40–78.8) | 30 (12–80) | NS |
COPD Gold stage | |||
Stage 1 | 2 | ||
Stage 2 | 4 | ||
Stage 3 | 5 | ||
Stage 4 | 1 |
Values are expressed as median (interquartile range) or frequencies;
Lung function test results.
COPD patients ( |
Controls ( |
|
|
---|---|---|---|
FEV1% | 49 (35–72) | 107 (80–120) | <0.001 |
FVC% | 64 (56–81) | 103 (87–120) | 0.001 |
FEV1/FVC ratio | 60 (45–70) | 79 (75–83) | <0.001 |
RV% | 165 (141–204) | 105 (79–139) | 0.045 |
TLC% | 112 (99–123) | 98 (94–112) | NS |
RV/TLC ratio | 56 (50–69) | 37 (28–45) | 0.001 |
DLCO% | 65 (27–94) | 82 (72–96) | NS |
KCO% | 84 (43–110) | 90 (77–106) | NS |
Values are expressed as median (interquartile range);
BM-MSCs from both COPD and healthy subjects were cultured to P2 and subsequently were characterized by their immunophenotypic characteristics and differentiation capacity. Immunophenotypic analysis demonstrated the presence of a homogenous cell population positive for CD73, CD90, and CD105 and negative for CD45, CD14, and CD34 antigens (Table
Flow cytometry results.
CD 73 | CD 90 | CD 105 | CD 45 | CD 14 | CD 34 | |
---|---|---|---|---|---|---|
MSCs | 98.2 (1.6) | 97.8 (1.65) | 97.8 (1.9) | 0.4 (1.77) | 0.3 (1.45) | 0 (0) |
Values are expressed as median (interquartile range).
CXCR4 mRNA levels were reduced in BM-MSCs of COPD patients, as Figure
Real-time RT-PCR results.
COPD patients ( |
Controls ( |
|
|
---|---|---|---|
CXCR4 | 0.05 (0.01–0.31) | 0.87 (0.34–1.35) | 0.01 |
SDF1a | 0.03 (0.01–0.06) | 0.32 (0.18–0.43) | 0.002 |
CCL19 | 0.001 (0.00–0.03) | 0.02 (0.004–0.04) | 0.01 |
CCL21 | 0.00 (0.00–0.04) | 0.04 (0.04–0.19) | 0.02 |
CCR7 | No expression | No expression | NS |
Values are expressed as median (interquartile range);
CXCR4 mRNA expression by BM-MSCs
SDF1a mRNA expression by BM-MSCs
BM-MSCs SDF1a mRNA levels were also significantly reduced in COPD relative to healthy subjects (0.03 versus 0.32 relative expression levels, resp.,
Additionally, serum SDF1a levels were higher in COPD patients as compared to healthy subjects; however, our results did not reach statistical significance (6358 versus 3941 pg/ml,
SDF1a protein levels in serum.
Notably, both SDF1a mRNA expression by BM-MSCs and serum protein levels were positively correlated to the severity of disease (GOLD stages) (rho = 0.59,
Correlations between SDF1a levels and severity of disease.
Real-time RT-PCR showed no detectable CCR7 mRNA expression in both groups. Nevertheless, its ligands’ expression was downregulated in BM-MSCs of COPD patients. Specifically, CCL19 (0.001 versus 0.02,
CCL19 mRNA expression by BM-MSCs
CCL21 mRNA expression by BM-MSCs
Our study aims to characterize the expression of chemokines and chemokine receptors involved in the migration of mesenchymal stem cells such as the SDF1/CXCR4 and CCR7/CCL19 CCL21 axes, in BM-MSCs of COPD patients in comparison to healthy subjects with similar age and smoking histories. Interestingly, our results showed decreased CXCR4 mRNA expression by BM-MSCs obtained from COPD patients suggesting a possible impairment of their migratory capacity. Similarly, mesenchymal cells from the COPD group expressed lower mRNA levels of SDF1a, CCL19, and CCL21 compared to controls; however, within the patient group SDF1a mRNA positively correlated with disease severity. Additionally, SDF1a serum protein levels were found elevated in the patient group and positively correlated to the severity of disease (GOLD stages) suggesting activation of SDF1a pathway in COPD. Our study suggests therefore a role of CXCR4/SDF1a axis in COPD pathophysiology that may lead to deregulation of the migration ability of stem cells from bone marrow.
Chronic inflammation and defects in repair mechanisms are considered key mechanisms in COPD development and progression of [
Stem cell exhaustion and senescence are considered potential pathogenetic mechanisms in COPD [
Our results also showed an increase in SDF1a serum levels of COPD patients, although statistical significance was not reached. Activation of the SDF1a pathway could be expected due to inflammation and tissue damage in the lung of COPD patients and our finding of elevated SDF1a levels could point to this direction; however this hypothesis requires further investigation. This assumption, further supported by the positive correlation of SDF1a serum levels with COPD stages, indicates an association of protein levels to the severity of the disease. SDF1 secretion from sites of tissue injury results in the increased migratory rates of progenitor cells and BM-MSCs [
Findings for SDF1a expression by cultured BM-MSCs are intriguing. SDF1a mRNA expression by COPD mesenchymal cells was significantly reduced compared to controls but protein levels in conditioned media were higher in COPD group. Our data imply the presence of a posttranscriptional regulation of SDF1a production by BM-MSCs in COPD. It is known that MSCs are expressing SDF1 but its role has not yet been fully elucidated [
Another chemotactic axis that has been studied as a possible regulator of mesenchymal stem cell migration is CCR7 and its ligands CCL19 and CCL21 [
There are limitations in our study, which need mentioning. First, the limited sample size due to the practical difficulties of patient recruitment is noteworthy. However, this was a pilot/guide study, investigating ex vivo BM-MSCs from COPD patients which, based on our results, should be expanded to a larger patient group. Additionally, since COPD is a heterogeneous disease, different disease stages may be reflected on BM-MSCs properties and should be taken into consideration in future studies. Considering that cigarette smoking may affect the migration of BM-MSCs even in subjects without COPD, another limitation of our study is the lack of a group of healthy nonsmokers. A future study comparing the migratory capacity of BM-MSCs between smokers and nonsmokers could provide new knowledge about the effect of cigarette smoking on stem cells.
In conclusion, our study demonstrates a downregulation of the CXCR4 mRNA expression by BM-MSCs in COPD patients, providing for the first time evidence from a human study that CXCR4/SDF1 axis is dysregulated in COPD. Additionally, it shows that COPD also affects SDF1a levels in serum and BM-MSCs. Although further studies are needed, we suggest that potential defects in migratory capacity of BM-MSCs may compromise their protective role, leading to development and progression of COPD.
The authors declare that there are no conflicts of interest regarding the publication of this paper.
The present study protocol has been awarded a grant from Hellenic Thoracic Society in 2008.