In the present study, a new technology that coupled constructed wetland (CW) with microbial fuel cell (MFC) (CW-MFC) was developed to convert solar energy into electricity on the principles of photosynthetic MFC by utilizing root exudates of
A microbial fuel cell (MFC) is a bioelectrochemical system making use of biocatalyst for converting chemical energy into electricity, and it has been considered as one of the promising and sustainable technologies for power generation as well as waste management [
Wetland treatment of wastewater has been widely practiced in several countries for many years due to its easy maintenance, low cost, and good self-purification capacity; moreover, it provides great quantities of biomass production by photosynthesis [
The concept of CW-MFC is based on constructed wetland and plant MFC (one form of photosynthetic MFC), of which all contain plants. The role of plants is important in the CW-MFC system, including their role in excreting oxygen and organic matter into the rhizosphere [
In this study, we built a single-chamber, membrane-free, continuously feeding upflow microbial fuel cell coupled with constructed wetland, in which the cathode is located in overlying water to use oxygen from air for reduction reactions, and the anode is submerged in a support matrix near the rhizosphere to obtain organic substrates in the influent or deprived from wetland plants root as fuel. The aim of this study was to evaluate whether or not the wetland plant (
As schematically shown in Figure
Schematic of the CW-MFCs used in the experiment.
The CW-MFCs were inoculated with the anaerobic sludge from a wastewater treatment plant located in Jiangning Development Zone (Nanjing, China) and operated by continuous feeding at a flow rate of 4.31 mL min−1 corresponding to a hydraulic retention time (HRT) of 2 d. The feed solution consisted of 50 mM phosphate buffer solution (PBS) with pH 7.4, glucose (0.20 g L−1), NH4Cl (0.15 g L−1), KCl (0.13 g L−1), NaHCO3 (3.13 g L−1), and 1 mL L−1 trace essential elements solution (contained per liter: 5.6 g (NH4)2SO4, 2 g MgSO4·7H2O, 200 mg MnSO4·H2O, 3 mg H3BO3, 2.4 mg CoCl2·6H2O, 1 mg CuCl2·2H2O, 2 mg NiCl2·6H2O, 5 mg ZnCl2, 10 mg FeCl3·6H2O, and 0.4 mg Na2MoO4·2H2O). All experiments were carried out in a 12:12-h light/dark cycle at
FISH analysis was applied to investigate the quantity of microorganisms on the anode and cathode in our study. Granular activated carbon with attached biofilm (wet weight of 0.5 g) was multisampled (parallel samples) and suspended in 5 mL sterile deionized water, and microorganism cells were detached from the GAC and uniformly dispersed in the solution with ultra-sonic oscillations treatment. About 0.5 mL supernatant after ultrasonic oscillations was shifted and suspended in phosphate-buffered saline solution (PBS, pH 7.4) consisting of 8 g L−1 NaCl, 0.2 g L−1 KCl, 1.44 g L−1 Na2HPO4, and 0.24 g L−1 K2HPO4 in distilled water. Then the samples were fixed with 4% paraformaldehyde (in PBS) at 4°C for 24 h. The fixed samples were washed twice with PBS, and suspended in a solution of 50% PBS, and 50% ethanol and stored at −20°C. For FISH, 10
In the FISH procedure, target microflora and oligonucleotide probes used were shown in Table
Probe name and probe sequence used for FISH analysis.
Probe | Target microflora | Probe sequence | References |
---|---|---|---|
EUB338 |
|
GCTGCCTCCCGTAGGAGT | [ |
GEO2 |
|
GAAGACAGGAGGCCCGAAA | [ |
HGEO2-1 | Helper probes for GEO2 | GTCCCCCCCTTTTCCCGCAAGA | [ |
HGEO2-2 | Helper probes for GEO2 | CTAATGGTACGCGGACTCATCC | [ |
BET42a |
|
GCCTTCCCACTTCGTTT | [ |
The cell voltage was recorded every 30 min by a data acquisition system (USB120816, Hytek Automation, Inc., Shanghai, China). The cell potentials were measured against a saturated Ag/AgCl (S) electrode. Polarization curves were obtained in the daytime (high peak voltage) by varying the external resistor over a range from 5 Ω to 105 Ω (105, 4000, 3000, 2000, 1000, 800, 600, 400, 200, 100, 75, 50, 25, 10, and 5 Ω) to monitor the output voltage. The current (
Chemical oxygen demand (COD), ammonia nitrogen (
Specific power yield (SPY) was obtained by dividing power generated (
The two CW-MFCs were operated for more than 1 month to obtain a stable performance before the determination of cell voltage. Figure
Continuous records of voltage with a fixed external load of 1000 Ω for the planted CW-MFC and unplanted CW-MFC. (a) A daily record of voltages at 0:00 (night through time) and 12:00 (day peak time) from May 3 to June 10; (b) half-hourly records of voltages from June 12 to June 16.
As shown in Figure
The performance of the planted CW-MFC was depicted and compared with the unplanted CW-MFC in terms of power density curves and polarization curves. It can be seen from Figure
Polarization curves of the planted CW-MFC and unplanted CW-MFC (solid symbols for the cell voltage and open symbols for the power density).
It was demonstrated that the catalytic activity of the electrode positively correlates with biomass [
Electrode potential and cell density in electrodes zone for the planted CW-MFC and unplanted CW-MFC: (a) cathode zone and (b) anode zone.
Throughout the experimental stage, the influent chemical oxygen demand (COD) and total nitrogen (TN) reached to the ranges of 193–205 mg L−1 and 31–39 mg L−1, respectively. More or less, the same COD removal efficiency (planted CW-MFC, 94.8%; unplanted CW-MFC, 92.1%) was noticed with both the CW-MFCs, but SPY (planted CW-MFC, 0.178 W Kg−1
In order to ascertain the reason for the difference of TN removal efficiencies between the CW-MFCs, the concentration of DO and various forms of nitrogen along the reactor height were investigated in the day time. DO had a “
The change of DO in the planted CW-MFC and unplanted CW-MFC.
Figures
The change of different forms of nitrogen in the planted CW-MFC.
The change of different forms of nitrogen in the unplanted CW-MFC.
In the planted CW-MFC, the accumulated
Under aerobic conditions,
When
The removal of nitrogen (including nitrate, nitrite, and ammonia) in MFC has been reported in recent years. In a MFC, nitrate and nitrite can be removed as electron acceptors in the cathode through electrochemical reduction or autotrophic denitrification [
The principal reactions for the overall process of the CW-MFC. (1) Plant roots secrete O2 and
Because of the alternating phases of light and dark, the electric output generated from plant photosynthetic products may show diurnal oscillations with clear fluctuations between the trough and the peak values [
The CW-MFC system can utilize the organic substrate in the influent and plant photosynthate as fuels, so its power output could be divided into two parts: power yield from
Conversion of solar energy into electricity can be fulfilled by coupling wetland plant photosynthesis with the microbial conversion of organics to electricity in CW-MFC system. The CW-MFC planted with
This work was financially supported by the National Natural Science Foundation of China (Grant no. 21277024).