Sarcopenia, the age-related decline in muscle mass and function, represents a significant health issue due to its associated high prevalence of frailty and disability [
Sirtuin 1 (SIRT1), a nicotinamide adenine dinucleotide- (NAD+-) dependent histone deacetylase [
To regulate the deficiencies of myocyte activity in elderly subjects, many methods are applied such as physical training, amino acid treatment, myostatin inhibition, testosterone treatment, calorie restriction, and noninvasive physical procedures like ultrasound therapy, electrical current modalities, and phototherapy [
Twenty female Sprague Dawley rats (18 months old, 378 ± 11 g) obtained from the experimental animal center in Guangzhou University of Traditional Chinese Medicine (GUTCM) (Guangzhou, China) were housed in plastic cages (five rats per cage) in a temperature controlled room (
The gallium-aluminum-arsenium (GaAlAs) laser (
On the last day of the experimental period, all rats were anaesthetized with pentobarbitone sodium (40 mg/kg) 24 h after LLLI irradiation. Bilateral gastrocnemius medialis muscles were then extracted and weighed. The proximal halves of the muscles were embedded in tragacanth gum, after which the samples were frozen in isopentane cooled by liquid nitrogen and were stored in a deep freeze (−80°C). And the distal halves of the muscles were immediately separated into the two blocks of superficial and deep regions, with each trimmed into 50 mg tissue samples. The superficial region of gastrocnemius muscle was organized with fast twitch fibres almost exclusively; however, the deep region included slow- and fast-twitch fibres [
Proteins content for Bax, Bcl-2, and IGF-1 were determined by western immunoblot analysis (Figure
Western blot analysis and densitometry ratios of BAX, Bcl-2, and IGF-1 in gastrocnemius. Western blot analysis is used to determine the level of proteins extracted from gastrocnemius, relative to the endogenous control
Total RNA was prepared from 100 mg of frozen muscle tissues using TRIzol (Invitrogen, Singapore) and was purified according to the instructions included. The RNA purity was verified by the OD260/OD280 on the ultraviolet spectrophotometric module of the Tecan Microplate Reader (Infinite 200, Switzerland). Double-stranded cDNA was synthesized from −1
Primers used for PCR amplification of cDNA.
Genes | Sense | Antisense |
---|---|---|
SIRT1 | CTGTTTCCTGTGGGATACCTGACT | ATCGAACATGGCTTGAGGATCT |
PGC-1a | CTACAATGAATGCAGCGGTCTT | TGCTCCATGAATTCTCGGTCTT |
NGF1 | GCATTGAGCTACTGACAGAC | CTGTGTCCTGGATCTTCCTT |
TFAM | TGGAACACAGCCACATGCTT | ACCATGGTGGCAAACTGTCT |
GAPDH | CTATCGGCAATGAGCGGTT | TGTGTTGGCATAGAGGTCTTTA |
SOD2 | CGTCATTCACTTCGAGCAGA | AAAATGAGGTCCTGCAGTGG |
Caspase 3 | TGGTTCATCCAGTCGCTTTGT | CAAATTCTGTTGCCACCTTTCG |
All data were presented as mean ± SE. All differences were analyzed by the student’s
Table
Weight, gastrocnemius weight, and gastrocnemius mass/body mass.
Groups | Body mass (g) | Gastrocnemius weight (g) | Gastrocnemius mass/body mass |
---|---|---|---|
CON | 378.8 ± 65.7 | 0.61 ± 0.16 | 1.60 ± 0.20 |
LLLI | 378.0 ± 27.6 | 0.84 ± 0.03* | 2.20 ± 0.11* |
Bcl-2 and IGF-1 protein expression in the gastrocnemius of the LLLI group are significantly elevated, while BAX expression is significantly inhibited, compared to the CON group (
The mRNA contents of SIRT1, PGC-1
It has been confirmed in many studies that 30% or more of skeletal muscle myocytes, particularly in fast-twitch fibers, may be lost with aging due to apoptosis. Andersen et al. [
It has been suggested that the age-related loss of muscle mass may be inhibited by LLLI [
A large number of studies using both rodent model and human subjects have confirmed that the mechanism for age-associated skeletal muscle fiber atrophy and myocyte loss is due to apoptosis [
Theoretically, the apoptotic signal in aging skeletal muscle may be partly wiped out by the LLLI [
mRNA quantification of SIRT1/PGC-1
IGF-1 may be a major factor in muscle regrowth during recovery from muscle injury. IGF-1 may control skeletal muscle growth in terms of both satellite cell proliferation [
IGF-I protein expression in aging skeletal muscle may theoretically be promoted with LLLI [
Age-related loss of SIRT1 mRNA may contribute to the decline in mitochondrial function with aging. Alterations in mitochondrial function and low mitochondriogenesis were considered major factors underlying sarcopenia [
SIRT1 mRNA expression in aging skeletal muscle may be theoretically promoted with LLLI [
The mechanism of LLLI promotion of SIRT1 expression and NAD+ level has not been well elucidated. LLLI was found to induce a significant increase in cAMP level via upregulating ATP content and mitochondrial membrane potential [
Schematic depiction of the cellular signaling pathways triggered by LLLI. After photons may be absorbed by chromophores in the cell membrane, mitochondria cytochrome C oxidase, MMP, ATP, and cAMP may be increased, but signaling pathways such as PKA/IGF-1 may be also increased, contributing to increased NAMPT/SIRT1 pathway and inhibited expression of
SIRT1 has been found to increase the transcription of PGC-1
The skeletal muscle of aged rats may be characterized by enhanced reactive oxygen species production compared with young rats. Aging may be associated with increased oxidative damage, leading to muscle dysfunction [
We recognize that our study evaluated skeletal muscle mass, marker of apoptosis, and gene expression of the expression of a group of genes involved in mitochondrial function and biogenesis in an animal model, so we understand that this represents a limitation and we express caution at extrapolating our findings into humans at this stage. Nevertheless, LLLI has a strong safety profile and reports of side effects in an evidence base of over 200 randomized controlled clinical trials are few and minor. Therefore, we believe serious consideration should be given to the potential of LLLI as a treatment option of long-term conditions like sarcopenia. Future studies would include investigation of the effects of LLLI on protein expression of mitochondrial biogenesis and oxidative capacity and functional aspects of sarcopenia and the determination of optimal parameters to inform the design of robust clinical trials. We hope that our findings may initiate interest in the use of LLLI as a potentially useful adjunct for sarcopenia.
LLLI at 810 nm inhibits sarcopenia associated with upregulation of Bcl-2/BAX ratio and IGF-1 and SIRT1/PGC-1
The authors declare that there is no conflict of interests regarding the publication of this paper.
Fang-Hui Li and Yan-Ying Liu contributed equally to this study and share first authorship.
This work was supported by National Science Foundation of China (60878061) and Guangdong Scientific Project (2012B031600004).