Testing systems for molecular identification of micropropagated elite aspen (
The continued degradation of native forests worldwide due to the overexploitation requires introduction of intensive forms of forestry that would favor not only economic effect but also conservation of woody plant genetic resources. This task declares obtaining and maintenance of elite genotypes of forest trees aimed for fast-rotated forest plantations. New highly productive and sustainable to abiotic factors, pests and pathogens cultivars and varieties appear as a result of breeding, selection of mutations, and/or genetic engineering. The clonal propagation of such outstanding individuals ensures fixation of their useful traits both for further breeding experiments and for establishment of targeted forest plantations. In particular, microclonal propagation via
Since morphologically and anatomically different plant clones may look similar, it is essential to reliably identify those including discrimination from each other and from conspecific individuals or representatives of other closely related species. In forestry, the problem of individual identification is especially crucial since the external look of trees is highly dependable on environmental parameters [
Molecular genetic markers (MGM) proved to be very efficient tools for individual identification. Among different MGM classes microsatellites or simple sequence repeats (SSR) fit best to requirements of testing systems for identification due to their specificity, codominance, selective neutrality, sufficient allelic richness, and heterozygosity caused by high mutation rate. Moreover, due to relative genome conservatism within genera and families of plants, SSR-markers and PCR primers for their amplification can be transferrable from one taxon to another.
In several poplar species, the successful DNA fingerprinting and differentiation of clones, cultivars, and varieties were demonstrated by molecular markers including SSR loci [
In this paper we report on the development of SSR-based testing system for molecular genetic identification of elite micropropagated genotypes of aspen,
The development of the testing system for the identification of elite genotypes comprised the selection of a specific marker set fitting the requirements of high-resolution discrimination of clones and testing its reliability and identification power on a set of elite genotypes and a sufficient number of representatives of a studied species.
Elite aspen and hybrid clones used for development of testing systems for molecular identification have been obtained from micropropagated cell cultures [
Elite aspen and hybrid clones and their characteristics.
Original genotype | Putative species/hybrid identity | Origin | Description | Clones and clonal lineages obtained based on original genotypes |
---|---|---|---|---|
PtV22 | Putatively |
Minsk Oblast, Belarus, breeding form obtained in Institute of Forest, National Academy of Belarus, Gomel, Belarus, provided by V. E. Padutov | Diploid green-bark aspen form. Characterized by fast growth and resistance to heart rot caused by pathogen fungus |
Ptv22-1, Ptv22-2, Ptv22-3, 21mut, 2mut, 14mut, 4mut, 12mut |
|
||||
Pt |
|
Leningrad Oblast, Russia, breeding form obtained in St. Petersburg Research Institute for Forestry, provided by D. A. Shabunin | Diploid giant aspen form. Characterized by fast growth and resistance to heart rot caused by pathogen fungus |
Pt2, Pt3 |
|
||||
F2 |
|
Kostroma Oblast, Russia, breeding form obtained by S. N. Bagayev, provided by D. A. Shabunin | Diploid female clone. Highly productive (plus 51% by sum of stem cross section squares and plus 43% by growing stock). Increased wood density of 475 kg/m3 [ |
F2-1, F2-2, F2-3 |
|
||||
47 |
|
Latvian State Forest Research Institute “Silava,” Latvia, provided by Dr. Arnis Gailis | Diploid aspen form. Productivity of 180–200 m3/haat age 12 under density of 1100 stems/ha. Characterized by resistance to heart rot caused by pathogen fungus |
47-1, 47-1-1-31, 47-1-1-22, 47-1-2-27, 47-1-1-19, 47-1-2-53 |
|
||||
С-control |
|
-“- | Diploid hybrid form. Productivity of 180–200 m3/ha at age 12 under density of 1100 stems/ha [ |
С-1, С-2, С-3 |
|
||||
23 |
|
-“- | Diploid hybrid form. Maximal productivity of 200–250 m3/ha demonstrated at age 12 under density of 1100 stems/ha [ |
L23-1, L23-2, L23-3 |
|
||||
4 |
|
-“- | Maximal productivity of 250–300 m3/ha demonstrated at age 12 under density of 2500 stems/ha [ |
L4-1, L4-2, L4-3 |
|
||||
No. 3-understory |
|
Republic of Tatarstan, breeding form by A. H. Gaziulllin, provided by N. R. Garipov | Triploid aspen form. Characterized by fast growth and resistance to heart rot caused by pathogen fungus |
No. 3-understory-1 |
Experimental aspen clonal plantations derived from these elite genotypes were established in four regions of European part of Russia (Figure
Map of location of plantations made of elite clones and corresponding native aspen stands used as reference populations. (1) Prisady, (2) Voronezh, and (3) Yoshkar-Ola.
In order to minimize the occasional sampling of individuals having vegetative origin (through sprouting) we collected leaves from trees at a distance not less than 15–20 m from each other. This approach was employed for inclusion into reference samples of predominantly open-pollinated seedlings having maximal genetic diversity. However, based exclusively on external look of the trees and distance among them, sampling of the ramets appearing as a result of sprouting could not be avoided, and subsequent genetic analysis confirmed this.
Shoots with leaves were cut off by means of mechanical cutter with an aluminium telescopic mast. Collected shoots with leaves were placed into plastic bags for no more than 6 days at +4°С until processing. Sample preparation included DNA extraction and placement of reserve leaf tissue fragments into labeled zip-bags with silica gel for long-term storage. Outside the period of active vegetation, dormant vegetative buds can be successfully used for DNA extraction.
Fragments of leaves approximately 350–500 mg taken from explants growing
For trees from native populations, we extracted DNA from 350–500 mg fragments of fresh or 200–300 mg of silica-dried leaf tissues by a modified cethyltrimethylammonium bromide (CTAB) method [
Microsatellites, or SSR, represent a class of tandemly repeated DNA sequences with short (1–6 pairs of nucleotides, bp) motifs differing in copy numbers among individuals due to high mutation rate. Multiple alleles usually found in codominant microsatellite loci create a great variety of unique genotypic combinations which ensures their reliable identification, especially when a sufficient number of loci are employed. Technically, the analysis of SSR polymorphism requires only Polymerase Chain Reaction (PCR) and subsequent electrophoresis (gel or capillary) for fragment analysis. For the development of the testing system we chose the variant of the method that utilizes only basic equipment and simple reagents. This ensured increased reproducibility of the procedures in any PCR laboratory and allowed achieving high cost-effectiveness of the analysis which is crucial for large-scale practical clone identification.
Since the substantial number of nuclear SSR loci for poplars was found in the literature and primer databases we decided to select from several publications and test primers that can be used for routine genotype identification based on very simple equipment without using of DNA-analyzers. An initial set of SSR primers for their potential use as elements of the testing system of molecular identification in aspen was a result of search in bibliographical databases (Thomson Reuters Web of Science,
DNA amplification was performed using PCRCore kits (Isogen Laboratories, Ltd., Moscow, Russia) in BioRad Inc. (USA) Dyad Thermo cycler. Microsatellite loci (listed in Table
Microsatellite loci tested for PCR amplification in aspen.
Loci | Primer sequences (5′- 3′) | Repeat motif | Fragment size (bp)3 |
---|---|---|---|
ORPM141 | F- GGGCTGCAGCAGATATTGA |
(GCTC)4 | 146–162 |
|
|||
ORPM181 | F- AGCAGAGATCGATGCTGAGG |
(TTTA)4 | 205 |
|
|||
ORPM361 | F- AGCCTCCAAACACCATGAAC |
(GAAA)4 | 213 |
|
|||
ORPM601 | F- ATAGCGCCAGAAGCAAAAAC |
(AAT)5 | 212 |
|
|||
ORPM791 | F- GAAGCTGAAAACAACAACAAACA |
(AAT)4 | 160 |
|
|||
ORPM811 | F- GCTGCAGCCAAACAAAGC |
(TATT)4 | 142–158 |
|
|||
ORPM841 | F- CTGCAGCCTTACCACCATTT |
(AAG)4 | 171 |
|
|||
ORPM861 | F- CCACATCCATAGCTCTGCAAC |
(CTT)5 | 204 |
|
|||
ORPM1071 | F- AATCTGGTGGCTTGCCTCT |
(TAAA)4 | 190 |
|
|||
ORPM1171 | F- CCCCCTAATTACCTTGGAAAC |
(ATTA)4 | 210 |
|
|||
ORPM1581 | F- GCTGAAACATCCTTCATGGTC |
(TTTC)4 | 200 |
|
|||
ORPM1931 | F- CCGCTGGATTTGTTTGTTTT |
(ATTTT)4 | 187–207 |
|
|||
ORPM2021 | F- TCGCAAAAGATTCTCCCAGT |
(TAA)5 | 184–190 |
|
|||
ORPM2061 | F- CCGTGGCCATTGACTCTTTA |
(GCT)7 | 190–208 |
|
|||
ORPM2201 | F- AGCTAGCCTGTCGTCAAGGA |
(TTTA)6 | 178–222 |
|
|||
ORPM2961 | F- CGAAGCCATTGACCCAGTAT |
(GTTCTG)4 | 199 |
|
|||
ORPM3121 | F- GTGGGGATCAATCCAAAAGA |
(CCT)6 | 194 |
|
|||
ORPM3661 | F- CCTTGAGGGGACACTTCGAT |
(TTA)5 | 156 |
|
|||
ORPM3711 | F- CCGGACTCTCACAAATCTCC |
(TCTT)6 | 192–200 |
|
|||
ORPM3721 | F- AGCTCTTCTGCTGGTGCTGT |
(TCTT)5 | 190 |
|
|||
ORPM4151 | F- CTCGGTGCAAATATCGGTTC |
(GGCG)4 | 225 |
|
|||
ORPM4841 | F- CAAAATGGCAATCCAAGGTT |
(TTAA)4 | 190–206 |
|
|||
ORPM4881 | F- CTCCAGCCGCTTCTATCCTT |
(TTA)6 | 200 |
|
|||
ORPM4961 | F- CAGCAGTGCAAGCTCCTAAA |
(GGA)4 | 185 |
|
|||
WPMS142 | F- CAGCCGCAGCCACTGAGAAATC |
(CGT)28 | 215–287 |
|
|||
WPMS152 | F- CAACAAACCATCAATGAAGAAGAC |
(CCT)14 | 201–219 |
|
|||
WPMS162 | F- CTCGTACTATTTCCGATGATGACC |
(GTC)8 | 139–184 |
|
|||
WPMS172 | F- ACATCCGCCAATGCTTCGGTGTTT |
(CAC)15 | 122–146 |
|
|||
WPMS182 | F- CTTCACATAGGACATAGCAGCATC |
(GTG)13 | 219–248 |
|
|||
WPMS192 | F- AGCCACAGCAAATTCAGATGATGC |
(CAG)28 | 180–234 |
|
|||
WPMS202 | F- GTGCGCACATCTATGACTATCG |
(TTCTGG)8 | 210–222 |
|
|||
WPMS212 | F- TGCTGATGCAAAAGATTTAG |
(GCT)45 | 287–326 |
|
|||
WPMS222 | F- ACATGCTACGTGTTTGGAATG |
(TGA)23 | 100–135 |
Comments: 1Tuskan et al., 2004 [
Results of testing of microsatellite loci in aspen.
Locus | PCR amplification | Fragment size range (bp) | Number of alleles | Status1 | Included in testing system |
---|---|---|---|---|---|
ORPM14 | Yes | 146–162 | 4 | P | No |
ORPM18 | No | — | — | N | No |
ORPM36 | Yes | 217 | 1 | M | No |
ORPM60 | No | — | — | N | No |
ORPM79 | No | — | — | N | No |
ORPM81 | No | — | — | N | No |
ORPM84 | No | — | — | N | No |
ORPM86 | Yes | 204–216 | 4 | P | No |
ORPM107 | No | — | — | N | No |
ORPM117 | Yes | 218 | 1 | M | No |
ORPM158 | Yes | 200 | 1 | M | No |
ORPM193 | Yes | 182–207 | 6 | P | Yes |
ORPM202 | Yes | 184–193 | 5 | P | Yes |
ORPM206 | Yes | 190–196 | 3 | P | Yes |
ORPM220 | Yes | 178–198 | 5 | P | Yes |
ORPM296 | Yes | 201–183 | 4 | P | Yes |
ORPM312 | Yes | 189–201 | 4 | P | No |
ORPM366 | No | — | — | N | No |
ORPM371 | Yes | 192–200 | 3 | P | No |
ORPM372 | No | — | — | N | No |
ORPM415 | Yes | ~280 | 1 | M | No |
ORPM484 | Yes | 190–206 | 3 | P | No |
ORPM488 | Yes | 197–203 | 2 | P | No |
ORPM496 | No | — | — | N | No |
WPMS14 | Yes | 224–243 | 3 | P | Yes |
WPMS15 | Yes | 189–207 | 5 | P | Yes |
WPMS16 | Yes | 139–184 | 9 | P | Yes |
WPMS17 | Yes | 122–146 | 7 | P | Yes |
WPMS18 | Yes | 219–248 | 7 | P | Yes |
WPMS19 | Yes | 210–252 | 9 | P | Yes |
WPMS20 | Yes | 210–222 | 4 | P | Yes |
WPMS21 | Yes | 196–240 | 5 | P | Yes |
WPMS22 | Yes | 115–135 | 3 | P | Yes |
1P: polymorphic, M: monomorphic, and N: no PCR amplification.
PCR products were subjected to electrophoresis in 6% polyacrylamide gel blocks using Tris-EDTA-borate buffer system. After electrophoresis gels were stained in ethidium bromide solution and visualized in UV-light, graphic images were captured and saved using Doc-Print II Vilber Lourmat gel documentation system and processed in graphical editors. Fragment size was estimated by means of specialized software (Photo-Capt). DNA of
Clone identity was determined using multilocus matches analysis for codominant data. Genotype probability (GP), meaning probability of appearance of particular multilocus combination in population, and probability of identity, estimating probability of random matching of two unrelated (PI) or related (PIsib) individuals by particular set of loci, were calculated based on distribution of allele frequencies in population samples.
Correspondence of observed genotype distributions for each SSR locus to the expected according Hardy-Weinberg equilibrium was tested by chi-square criterion. Allele number and observed and expected heterozygosities were calculated for each native sample. We employed Wright’s
For initial testing, we selected 33 heterological tri-, tetra-, penta-, and hexanucleotide microsatellite loci from two sets; series ORPM was designed first for
As a result of the first phase of testing, 24 loci were successfully amplified and nine other loci failed to produce PCR products. Out of 24 loci that produced PCR fragments, 20 loci were shown to be variable with a number of alleles from two to nine, while four loci that have been successfully amplified were monomorphic (Table
(a) Electrophoretic patterns of PCR-amplified SSR loci
The obtained multilocus genotypes of eight elite clones and reference genotypes of wild trees from native stands are listed in Table S1 in Supplementary Material available online at
Relationship of PI and PIsibs from the number of used loci. 1 represents locus 1, 2 represents loci 1 + 2, and so forth.
Development of microsatellite loci for species of the genus
Next generation sequencing was the most efficient way of detection of tandem repeats in poplar genome and design on their base transferrable SSR primers as it was demonstrated in case of balsamic poplar,
Microsatellites are also useful for checking of somaclonal diversity within a pool of ramets obtained by microclonal propagation from a single donor tree [
Since the very moment of the field sampling of material in wild stands we tried to avoid inclusion of clonal ramets arised as sprouts which is common for aspen. In all studied stands the same sampling scheme was applied keeping at least 15–20 m between the trees. Nevertheless, ramets of the same clone indicating common occurrence of vegetative propagations were found in all of the studied natural populations (Table S1).
We concluded that sprouting and high level of clonality are a widespread phenomenon in native aspen stands. In aspen, as well as in many other poplars, vegetative clones are able to occupy large areas. Therefore, for the collection of a sample free of repeated clonal genotypes distances between trees should be increased up to at least 40–50 m. However, more precise estimation of maximal spread of a single clone over stand territory also requires special exploration.
Among other applications, nuclear SSR loci were useful for the studies of clonal structure and genetic relationships among clone genotypes in native stands [
All the loci of the selected set were polymorphic in all studied native population samples. Values of average allele number, effective allele number, and observed and expected heterozygosity were slightly higher in
Parameters of genetic variability in aspen populations.
Population |
|
|
|
|
|
|
| |
---|---|---|---|---|---|---|---|---|
Prisady | Mean | 41 | 6.429 | 3.921 | 0.631 | 0.661 | 0.669 | 0.047 |
s.e. | 0.850 | 0.602 | 0.059 | 0.044 | 0.045 | 0.065 | ||
Voronezh | Mean | 25 | 7.429 | 3.970 | 0.580 | 0.687 | 0.701 | 0.188 |
s.e. | 1.274 | 0.584 | 0.068 | 0.035 | 0.036 | 0.076 | ||
Yoshkar-Ola | Mean | 13 | 4.643 | 2.738 | 0.522 | 0.567 | 0.590 | 0.109 |
s.e. | 0.541 | 0.343 | 0.072 | 0.043 | 0.045 | 0.087 | ||
Total mean | Mean | 26.333 | 6.167 | 3.543 | 0.578 | 0.639 | 0.654 | 0.115 |
s.e. | 1.791 | 0.558 | 0.308 | 0.038 | 0.024 | 0.025 | 0.044 |
s.e.: standard error.
The averaged over loci
Locus |
|
|
|
---|---|---|---|
|
0.158 | 0.230 | 0.086 |
|
0.514 | 0.593 | 0.164 |
|
0.276 | 0.363 | 0.120 |
|
0.066 | 0.096 | 0.032 |
|
0.046 | 0.067 | 0.023 |
|
0.074 | 0.224 | 0.162 |
|
−0.187 | −0.144 | 0.036 |
|
−0.105 | −0.083 | 0.019 |
|
−0.066 | −0.028 | 0.036 |
|
0.305 | 0.322 | 0.025 |
|
−0.034 | −0.003 | 0.029 |
|
0.111 | 0.131 | 0.023 |
|
−0.057 | −0.027 | 0.028 |
|
0.563 | 0.578 | 0.035 |
|
|||
Mean | 0.119 | 0.166 | 0.058 |
s.e. | 0.060 | 0.062 | 0.014 |
s.e.: standard error.
Microsatellites isolated from nuclear as well as chloroplast genomes were employed for the analysis of genetic diversity and genetic structure in various poplar species [
A substantial number of studies employing microsatellite technique were focused on the detection of hybridization in natural [
The practical task of identity monitoring of commercial clones in
Application of nuclear microsatellite loci for genetic identification and assessment of genetic variability in aspen elite clones and native stands showed high effectiveness of the developed low-cost SSR-based testing system. Reliable authentication of clones ensures genetic monitoring of microclonal propagation and allows revealing clonality in native stands. We demonstrated that the same set of microsatellite loci can be successfully employed for estimation of levels of intra- and interpopulation genetic variability in aspen. Reconstruction of kinship among individual elite clones or genetic relationships of naturally mating populations are perspective tasks that can be realized in the future using the same markers.
The authors declare that there is no conflict of interests regarding the publication of this paper.
This research is supported by the Ministry of Education and Science of the Russian Federation (Project no. 14.607.21.0044 from 22.08.2014; unique identifier RFMEFI60714X0044). The authors also thank E. M. Romanov, A. I. Shurgin, R. V. Sergeev (Volga State University of Technology, Yoshkar-Ola, Republic of Mari El, Russia), M. V. Drapaluk, A. V. Tzaralunga, A. A. Reshetnikov, E. O. Kolesnikova (Voronezh State Forestry Engineering University, Voronezh, Russia), and G. B. Kolganikhina (Institute of Forest Science RAS, Uspenskoe, Moscow region, Russia), for their help with sample collection in native stands. The authors are also grateful to M. Zeps, D. Auzenbaha, and A. Gailis (Latvian State Forest Research Institute “Silava,” Salaspils, Latvia) for sharing biological material and information on aspen elite clones.