Genetic factors contribute to about a half of coronary artery diseases. During the last several decades, some studies suggested that non-O blood group and thrombomodulin polymorphism −33G>A are the risk factors of coronary artery disease especially in Asia. There was no prior study in Indonesia regarding this issue. Hence, this study was designed to investigate the correlation of ABO polymorphism and thrombomodulin polymorphism −33G>A with the incidence of acute myocardial infarction (AMI). A total of 192 subjects were enrolled in this case control study. AMI patients were diagnosed based on World Health Organization criteria. Healthy patients were subjects with AMI risk factor without any sign and symptoms of AMI. Patients with diabetes mellitus, cancer, and arrhythmia were excluded from this study. Genotyping for both polymorphisms was performed by PCR RFLP methods. The result of this study suggested that ABO polymorphism and thrombomodulin polymorphism −33G>A were not risk factors of AMI, p=0.727 and p=0.699, respectively. Furthermore, the analysis to identify the synergy of these polymorphisms failed to prove their correlation with AMI (p=0.118). Conclusively, this study showed that ABO polymorphism and thrombomodulin polymorphism −33G>A were not risk factors of AMI.
1. Introduction
Coronary artery disease is the leading cause of death and disability in the world [1]. Acute myocardial infarction (AMI) is the most serious clinical manifestation of coronary artery disease leading to irreversible heart necrosis due to prolonged ischemia [2]. Genetic factors contribute to about a half of coronary artery diseases [3].
During the last several decades, some studies suggested that non-O blood group was a risk factor of myocardial infarction. Previous study on Caucasians revealed that blood group was a determinant of myocardial infarction susceptibility [4]. There is no prior study in Indonesia regarding this issue. This issue was explained by modulation of von-Willebrand Factor (vWF) by A and B glycosyltransferase [5]. Moreover, non-O blood group has 25% higher level of vWF compared to that of O blood group [6].
Thrombomodulin polymorphism −33G>A was reported as a determinant of myocardial infarction susceptibility in Asia [7–9]. Thrombomodulin gene produces thrombomodulin as a receptor in endothelial cell surface area and makes a complex with thrombin. This complex activates C protein that cleaves factor V and factor VIII. Thrombin-thrombomodulin complex will lose all of its procoagulant activity [10]. Polymorphism in the promoter region of this gene will lead to the decline of thrombomodulin gene expression [8, 11].
In Indonesia, we have no data regarding those issues; ethnic differences may contribute to this fact. Hence, this study was designed to investigate the correlation of ABO polymorphism and thrombomodulin polymorphism −33G>A with the incidence of acute myocardial infarction in Javanese men.
2. Patients and Method2.1. Patients
A case control study was conducted in a total of one hundred and ninety-two subjects. Myocardial infarction was diagnosed by cardiologists based on World Health Organization criteria, that is, the manifestation of any 2 of the following 3 criteria: cardiac chest pain, electrocardiography changes in 2 consecutive leads that showed ST elevation or ST depression, and troponin I level increase in 4 hours after onset. Moreover, control subjects were patients with myocardial infarction risk factors such as smoking, hypertension, and dyslipidemia. Mostly, the control group was obtained from hypertensive community patients. Patients with diabetes mellitus, vascular disease, cancer, and arrhythmia were excluded from this study. This study excluded patients with diabetes mellitus and vascular disease since ABO gene and thrombomodulin −33G>A polymorphism were polymorphism in thrombotic pathway and diabetes mellitus and vascular disease significantly enhanced the thrombotic event that consequently enhances the acute myocardial infarction risk.
2.2. Methods
Thrombomodulin −33G>A polymorphism was identified by PCR RFLP method. The primers were forward: 5′-GGCCAGGGCTCGAGTTTATAAAGGC-3′ and reverse: 5′-CGGGGACAGTCGTCTTGTTACAGG-3′. Furthermore, the 259 bp PCR product was digested by Stu I enzyme and electrophoresed in 3% agarose gel. GG genotype resulted in 235 bp, AG genotype 235 bp and 24 bp, and AA genotype 235 bp [10].
ABO polymorphism was identified by PCR RFLP method with the primers shown in Table 1. Furthermore, the PCR product was digested by Kpn and Alu I enzyme and electrophoresed in 3% agarose gel. The RFLP result was interpreted based on the previous research [12].
Primer in ABO polymorphism identification.
Primer
Sequence (5′-3′)
Name
ABO-1
GCAGTAGGAAGGATGTCCTC
A7500 (261F)
ABO-2
AATGTCCACAGTCACTCGCC
A7501 (261R)
ABO-3
TGGAGATCCTGACTCCGCTG
A7502 (703F)
ABO-4
GTAGAAATCGCCCTCGTCCTT
A7503 (703R)
2.3. Statistical Analysis
The data were analyzed by chi-square test. Difference was found to be significant if p<0.05.
2.4. Ethical Considerations
The study obtained ethical clearance from Medical and Health Research Ethics Committee (MHREC), Faculty of Medicine, Gadjah Mada University, Dr. Sardjito General Hospital. The informed consent was obtained prior to study enrollment.
3. Results
The baseline characteristics of the sample (Table 2) showed that there were no significant differences in age, body height, and the presence of dyslipidemia. Significant difference between two groups was observed in body mass index, smoking status, and hypertension. The incidence of hypertension was significant in control group since most of the control group was obtained from hypertensive community patients.
Baseline characteristics.
Variables
Case (n=99)
Control (n=93)
p
Age
56,45 ± 9,70
56,19 ± 9,79
0,853∗
BMI (kg/m2)
Normal (18.25 to <25)
39 (39,4)
23 (24,7)
0,004#
Overweight (25 to <30)
24 (24,2)
18 (19,4)
Obese 1 (30 to <35)
26 (26,3)
42 (45,2)
Obese 2 (35 to <40)
6 (6,1)
10 (10,8)
Dyslipidemia (yes)
39 (39,4)
40 (43)
0,717#
Smoking (yes)
81 (81,8)
42 (45,2)
0,000#
HT (yes)
42 (42,4)
83 (89,2)
0,000#
Data is represented in n (%). ∗Data were analyzed by independent t-test. #Data were analyzed by chi-square test. BMI: body mass index.
Chi-square analysis of ABO polymorphism based on O and non-O blood group with the incidence of myocardial infarction showed that both blood groups had similar risk factor of myocardial infarction (Table 3). Furthermore, analysis between thrombomodulin −33G>A polymorphism and myocardial infarction suggested that carriers of GG genotype had similar risk factor of myocardial infarction compared to that of AG/AA genotype (Table 4). Moreover, analysis of the synergistic effect of both polymorphisms on myocardial infarction showed no significant difference. All groups showed no difference in myocardial infarction susceptibility compared to that of the reference gene (Table 5).
Association between ABO gene polymorphism −33G>A and acute myocardial infarct based on blood groups O and non-O.
Variables
Cases (n=99)
Control (n=93)
p
OR
95% CI
O
22 (22,2)
17 (18,3)
0,618
0,727
0,355–1,490
Non-O
77 (77,8)
76 (81,7)
Data presented in n (%).
Association of thrombomodulin gene polymorphism −33G>A with acute myocardial infarction.
Variables
Case (n=99)
Control (n=93)
p
OR
95% CI
GG
91 (91,9)
83 (89,2)
0,699
1,37
0,516–3,637
AG/AA
8 (8,1)
10 (10,8)
Data presented in n (%).
Synergistic association between thrombomodulin −33G>A gene polymorphisms and ABO gene polymorphism with the occurrence of acute myocardial infarct.
Variables
Case (n=99)
Control (n=93)
p
OR
95% CI
GG/O
22 (22,2)
14 (15,1)
Reference gene
GG/non-O
71 (71,8)
69 (74,2)
0,354
0,5
0,423–0,591
AG/AA and non-O
6 (6)
7 (7,5)
0,544
1,833
0,51–6,593
AG/AA and O
0 (0)
3 (3,2)
0,148
0,389
0,258–0,586
Data presented in n (%).
4. Discussion
This study revealed different proportion of ABO phenotype compared to those of other populations. A study in Pakistan showed that the prevalence of blood group in ischemic heart disease was A 34%, B 29%, AB 14%, and O 23% [13]. This study showed the prevalence of blood group phenotype among myocardial infarction patients was A 54.5%, B 21.2%, O 22.2%, and AB 2%.
Some previous studies on Caucasians suggested the correlation of ABO polymorphism and myocardial infarction [14–17]. This study categorized the sample based on O and non-O blood group. The result of this study is similar to previous study in China and South China (Table 6). Both studies used more than 2000 samples and identified some gene polymorphisms that became the risk factor of myocardial infarction in Caucasians in China population. Both studies revealed that ABO polymorphism that increases the susceptibility of myocardial infarction in Caucasian population failed to give significant result in China population [18, 19]. Ethnicity difference may contribute to the result of this study.
Research summary of ABO gene polymorphisms on other populations.
Author
Research subject
Sample number
OR (95% CI)
Wang et al.
China subject
1,03 (0,8–1,33)
AMI cases
2365
Control
2768
Huang et al.
Southern China subject
1,279 (0,713–2,452)
AMI cases
1716
Control
1572
Biswas et al.
Indian subject
1,857 (1,112–3.1)
CAD cases
250
Control
250
AMI: acute myocardial infarction and CAD: coronary acute disease.
ABO polymorphism increases the susceptibility to myocardial infarction through some pathways, such as increasing vWF level, soluble intercellular adhesion molecule-1 level, soluble P-selectin level, and soluble E-selectin level [20]. However, the half-life of vWF and other cytokines was short (around 10 hours); therefore, we could not measure the vWF level. Moreover, ABO polymorphism affected circulated lipoprotein, triglyceride, and total cholesterol level [21]. This study revealed no significant difference in total cholesterol, triglyceride, HDL, and LDL between O and non-O blood group. This fact might explain the result of this study.
ABO polymorphism cannot affect the myocardial infarction susceptibility solely. There must be another gene that synergistically increases the susceptibility. Thrombomodulin gene polymorphism was a polymorphism that is more commonly found in Asian population. However, some studies in other Asia regions suggested conflicting result (Table 7). A study in Korea revealed that carriers of −33G>A thrombomodulin polymorphism had 4.63 times higher susceptibility to myocardial infarction [8]. Moreover, meta-analysis by Wang and Dong suggested that −33G>A polymorphism increases the susceptibility to coronary artery disease (OR = 1,65; 95% CI, 1,35–2,02; p<0,01; I2 = 15%) [22]. However, this study revealed no significant correlation between thrombomodulin polymorphism −33G>A and myocardial infarction. A study by Zhao et al. in 808 coronary artery disease patients and 813 healthy patients also failed to demonstrate a significant result [10]. Different genetic variation in different population might explain these different results.
Research summary of thrombomodulin gene polymorphisms on other populations.
This study showed that ABO polymorphism and thrombomodulin polymorphism −33G>A were not risk factors of AMI in Javanese males.
Conflicts of Interest
The authors declare that they have no conflicts of interest.
YusufS.ReddyS.ÔunpuuS.AnandS.Global burden of cardiovascular diseases. Part I: general considerations, the epidemiologic transition, risk factors, and impact of urbanization2001104222746275310.1161/hc4601.0994872-s2.0-0035960630SoutoJ. C.AlmasyL.Muñiz-DiazE.SoriaJ. M.BorrellM.BayénL.MateoJ.MadozP.StoneW.BlangeroJ.FontcubertaJ.Functional effects of the ABO locus polymorphism on plasma levels of von Willebrand factor, factor VIII, and activated partial thromboplastin time2000208202420282-s2.0-003388971010.1161/01.ATV.20.8.2024MarenbergM. E.RischN.BerkmanL. F.FloderusB.De FaireU.Genetic susceptibility to death from coronary heart disease in a study of twins1994330151041104610.1056/nejm1994041433015032-s2.0-0028330005WigginsK. L.SmithN. L.GlazerN. L.RosendaalF. R.HeckbertS. R.PsatyB. M.RiceK. M.LumleyT.ABO genotype and risk of thrombotic events and hemorrhagic stroke2009722632692-s2.0-5904908433010.1111/j.1538-7836.2008.03243.xJenkinsP. V.O'DonnellJ. S.ABO blood group determines plasma von Willebrand factor levels: a biologic function after all?200646101836184410.1111/j.1537-2995.2006.00975.x2-s2.0-33748926468O'DonnellJ.LaffanM. A.The relationship between ABO histo-blood group, factor VIII and von Willebrand factor20011143433512-s2.0-003489273210.1046/j.1365-3148.2001.00315.xLiY.-H.ChenJ.-H.WuH.-L.ShiG.-Y.HuangH.-C.ChaoT.-H.TsaiW.-C.TsaiL.-M.GuoH.-R.WuW.-S.ChenZ.-C.G-33A mutation in the promoter region of thrombomodulin gene and its association with coronary artery disease and plasma soluble thrombomodulin levels20008518122-s2.0-003396822110.1016/S0002-9149(99)00597-4ParkH.-Y.NabikaT.JangY.KwonH. M.ChoS. Y.MasudaJ.Association of G-33A polymorphism in the thrombomodulin gene with myocardial infarction in Koreans20022533893942-s2.0-003599110810.1291/hypres.25.389YamadaY.IzawaH.IchiharaS.TakatsuF.IshiharaH.HirayamaH.SoneT.TanakaM.YokotaM.Prediction of the risk of myocardial infarction from polymorphisms in candidate genes2002347241916192310.1056/NEJMoa0214452-s2.0-0037069779ZhaoJ.ZhouX.HuangJ.ChenJ.GuD.Association study of the thrombomodulin -33Ggt;A polymorphism with coronary artery disease and myocardial infarction in Chinese Han population200510038338810.1016/j.ijcard.2004.05.007LiY.-H.ChenJ.-H.TsaiW.-C.ChaoT.-H.GuoH.-R.TsaiL.-M.WuH.-L.ShiG.-Y.Synergistic effect of thrombomodulin promoter -33G/A polymorphism and smoking on the onset of acute myocardial infarction2002878691Al-BustanS.El-ZawahriM.Al-AzmiD.Al-BashirA.-A.Allele frequencies and molecular genotyping of the ABO blood group system in a Kuwaiti population20027521471532-s2.0-003646383710.1007/BF02982019SharifS.AnwarN.FarasatT.NazS.ABO blood group frequency in ischemic heart disease patients in Pakistani population201430359359510.12669/pjms.303.45022-s2.0-84897492943BiancariF.SattaJ.PokelaR.JuvonenT.ABO blood group distribution and severity of coronary artery disease among patients undergoing coronary artery bypass surgery in Northern Finland20021082-31951962-s2.0-003687733410.1016/S0049-3848(03)00003-3HeM.WolpinB.RexrodeK.MansonJ. E.RimmE.HuF. B.QiL.ABO blood group and risk of coronary heart disease in two prospective cohort studies2012329231423202-s2.0-8486545698810.1161/ATVBAHA.112.248757JukicI.Bingulac-PopovicJ.DogicV.HecimovicA.BabicI.BatariloI.MaglovC.SturmD.Evaluation of ABO blood groups as a risk factor for myocardial infarction20131134644652-s2.0-8488244638710.2450/2012.0065-12MiñanoA.OrdóñezA.EspañaF.González-PorrasJ. R.LecumberriR.FontcubertaJ.LlamasP.MarínF.EstellésA.AlbercaI.VicenteV.CorralJ.AB0 blood group and risk of venous or arterial thrombosis in carriers of factor V Leiden or prothrombin G20210A polymorphisms20089357297342-s2.0-4344913271210.3324/haematol.12271HuangE.-W.PengL.-Y.ZhengJ.-X.WangD.TanX.-H.YangZ.-Y.LiX.-M.WuQ.-P.TangS.-B.LuoB.QuanL.LiuS.-P.LiuX.-S.LiZ.-H.ShiH.LvG.-L.ZhaoJ.LiuC.ChengJ.-D.Investigation of associations between ten polymorphisms and the risk of coronary artery disease in Southern Han Chinese20166153893932-s2.0-8497125514910.1038/jhg.2015.158WangY.WangL.LiuX.ZhangY.YuL.ZhangF.LiuL.CaiJ.YangX.WangX.Genetic variants associated with myocardial infarction and the risk factors in Chinese population2014912-s2.0-8489993819710.1371/journal.pone.0086332e86332KiechlS.ParéG.BarbalicM.QiL.DupuisJ.DehghanA.BisJ. C.LaxtonR. C.XiaoQ.BonoraE.WilleitJ.XuQ.WittemanJ. C. M.ChasmanD.TracyR. P.BallantyneC. M.RidkerP. M.BenjaminE. J.YeS.Association of variation at the ABO Locus with circulating levels of soluble intercellular adhesion molecule-1, Soluble P-selectin, and Soluble E-selectin: a meta-analysis20114668168610.1161/CIRCGENETICS.111.9606822-s2.0-84856097166ChenY.ChenC.KeX.XiongL.ShiY.LiJ.TanX.YeS.Analysis of circulating cholesterol levels as a mediator of an association between ABO blood group and coronary heart disease20147143482-s2.0-8489873113010.1161/CIRCGENETICS.113.000299WangH.DongP.Thrombomodulin - 33G/A and Ala455Val polymorphisms are associated with the risk of coronary artery disease: a meta-analysis including 12 584 patients2015261727710.1097/MCA.00000000000001612-s2.0-84918580472