Positional cloning of lymphopenia (lyp) in the BB rat revealed a frameshift mutation in Gimap5, a member of at least seven related GTPase Immune Associated Protein genes located on rat chromosome 4q24. Our aim was to clone and sequence the cDNA of the BB diabetes prone (DP) and diabetes resistant (DR) alleles of all seven Gimap genes in the congenic DR.lyp rat line with 2 Mb of BB DP DNA introgressed onto the DR genetic background. All (100%) DR.lyp/lyp rats are lymphopenic and develop type 1 diabetes (T1D) by 84 days of age while DR.+/+ rats remain T1D and lyp resistant. Among the seven Gimap genes, the Gimap5 frameshift mutation, a mutant allele that produces no protein, had the greatest impact on lymphopenia in the DR.lyp/lyp rat. Gimap4 and Gimap1 each had one amino acid substitution of unlikely significance for lymphopenia. Quantitative RT-PCR analysis showed a reduction in expression of all seven Gimap genes in DR.lyp/lyp spleen and mesenteric lymph nodes when compared to DR.+/+. Only four; Gimap1, Gimap4, Gimap5, and Gimap9 were reduced in thymus. Our data substantiates the Gimap5 frameshift mutation as the primary defect with only limited contributions to lymphopenia from the remaining Gimap genes.
1. Introduction
Lymphopenia (lyp) is a prerequisite for spontaneous
type 1 diabetes (T1D) in the BioBreeding (BB) diabetes prone (DP) rat [1]. Positional cloning of the lyp gene revealed a frame shift mutation
in Gimap5 (previously known as Ian5 or Ian4L1). Gimap5 is a member of at least seven
related GTPase Immune Associated Protein (Gimap)
genes located within 150 Kilobases (Kb) on rat chromosome (RNO) 4 [2, 3]. DR.lyp/lyp rats, where 2 Mb of DP DNA was introgressed onto the BB diabetes resistant (DR)
genetic background, are lymphopenic and 100% develop spontaneous T1D by 84 days
of age [4].
The positional cloning and
subsequent identification of the Gimap5 gene on RNO4 were in part established through generation of the DR.lyp congenic rat line along with
recombination events following our method of marker assisted breeding of DP
with F344 rats [2, 4, 5]. Analysis of the lyp phenotype in the F344 DNA recombinant rats helped us define the
critical lyp interval as a region of
approximately 33 Kb between D4Rhw6 (76.83 Mb) and IIsnp3 (77.16 Mb) containing Gimap1, Gimap5, and Gimap3 (formerly known as Ian2, Ian5,
and Ian4, resp.) [2, 4]. Gimap5 was
identified as the lyp gene in the
BBDP rat through a frameshift mutation and premature truncation of the Gimap5
protein [2, 6]
and can be rescued in a P1-derived artificial chromosome (PAC) transgenic rat [7].
However, potential contributions to lymphopenia and/or T1D from the other Gimap genes are still unknown. Similarly, how the mechanisms by which
reduced Gimap5 transcript levels and
the absence of the Gimap5 protein [2, 7, 8]
contribute to lymphopenia and T1D are still being elucidated [9–13].
The predicted structures of the
Gimap proteins show common sequences and motifs, such as GTP-binding domains in
the N-terminal half, but with differing C-terminal ends [2, 3]. Some C-terminal regions are consistent with
transmembrane domains as in the case of
Gimap1 and Gimap5, while others, as in Gimap9 and Gimap4, predict coiled
coil domains [3, 14]. Both GIMAP4 and GIMAP7 from human Jurkat
cells [3] localize to the endoplasmic
reticulum and Golgi apparatus while
mouse Gimap3 from murine IL-3-dependent 32D myeloid precursor cells was
expressed at the outer mitochondrial membrane [15]. Conflicting reports show that GIMAP5, from
human primary T cells [10]
and from GIMAP5 transfected 293T cells [16], localizes to the centrosome,
Golgi apparatus, or
endoplasmic reticulum (ER), whereas Gimap5, cloned from Rat2 fibroblasts,
localizes to a distinct subcellular fraction that is neither mitochondrial nor ER
[11]. Gimap proteins may therefore have similar
function, but different subcellular locations.
At this time, there is a paucity of information as to the expression of
the Gimap genes in specific cell
types.
The fact that the Gimap genes are located together in a tight cluster on RNO4 (and in conserved synteny
with many other species), combined with their sequence similarities, suggests
the possibility that the proteins carry out similar function. While there is sufficient evidence to support
the frameshift mutation in Gimap5 as
the cause of lymphopenia, we could not exclude that either Gimap1 or Gimap3 play a
role, as they are located within the lymphopenia critical interval between
D4Rhw6 and IIsnp3 as well as within the PAC used in the transgenic rescue of
lymphopenia [7]. In addition, it is possible that the
remaining Gimap family members
outside the lymphopenia critical interval play a role in T1D development. In order to substantiate the frameshift mutation
in Gimap5 and the subsequent protein
null allele as the cause of lymphopenia as well as explore a possible
contribution by other Gimap family
members, we sequenced DR.+/+ and DR.lyp/lyp cDNA from
rat thymus. In addition, we examined Gimap gene expression across multiple
tissues and quantified mRNA expression of all annotated and putative Gimap genes in DR.+/+ and DR.lyp/lyp rat thymus, spleen, and mesenteric lymph node
(MLN).
2. Materials and Methods2.1. Dr.lyp Congenic Rats
The DR.lyp (BBDR.BBDP-(D4Rhw17-SS99306861) (D4Rhw11-D4Rhw10)/Rhw) congenic rat line was derived from
animals with two independent recombination events developed from our previously
described introgression of the lymphopenia locus by cyclic cross-intercross
breeding of BBDP with BBDR rats [17]. The first recombination event was flanked by
simple sequence length polymorphism (SSLP) marker D4Rhw11 (76.81 Mb) and the
second flanked by SSLP marker D4Rhw10 (77.81 Mb) [4]. Thus, the DP DNA in the DR.lyp rat line encompasses the lyp critical interval from D4Rhw6 (76.83 Mb) to IIsnp3 (77.16 Mb) [2]. In addition, the DR.lyp congenic rat line used in the present study also contains BBDP
DNA at D4Rat102 (66.22 Mb) and D4Rat26 (69.18 Mb). The DR.lyp congenic rat line is kept in sister-brother breeding and produces Mendelian
proportions of the DR.lyp/lyp (25%), DR.lyp/+ (50%), and DR.+/+ (25%) genotypes. DR.lyp/lyp are 100% lymphopenic and 100% diabetic.
2.2. Housing
Rats were housed in
a specific pathogen—free facility at
the University of Washington, Seattle, Washington, on a 12-hour light/dark cycle
with 24-hour access to food (Harlan Teklad, Madison, Wis, USA) and water. All protocols
were approved by the institutional animal use and care committee of the University of Washington,
Seattle, Wash, USA. The University of Washington
Rodent Health Monitoring Program
was used to
track infectious agents via a quarterly sentinel monitoring system. Excluded
infectious agents are listed at
http://depts.washington.edu/compmed/rodenthealth/index.html#excluded.
2.3. RNA Isolation
Thymus,
spleen, and mesenteric lymph nodes were homogenized from 45–78-day-old DR.lyp rats (7 male, 8 female) immediately
after dissection in RNA lysis solution (Stratagene, La Jolla, CA or Qiagen,
Valencia, Calif, USA) either with a pestle (Kontes, Vineland, NJ, USA) and, if viscous, passed
through a 20 gauge needle or a Kinematica Polytron PT
10/35 (Brinkmann, Westbury, NY, USA). Bone
marrow was obtained by flushing the femora and tibia with Dulbecco’s modified
medium (Life Technologies, Grand
Island, NY, USA). Nucleated cells were separated with
lympholyte-rat (1.094g/cm3, Cedarlane
Lab, Ontario, Canada) according to the
manufacturer’s protocol. Total RNA was
isolated using either RNeasy (Qiagen) or Absolutely RNA Miniprep Kit
(Stratagene) followed by treatment with DNase.
PolyA+ RNA was isolated with Oligotex Direct mRNA Midi/Maxi Kit,
(Qiagen). Total RNA was quantitated with RiboGreen
(Stratagene).
2.4. cDNA Cloning and Sequencing
cDNA
synthesis was performed using SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, Calif, USA)
according to the manufacturer’s recommendations. PCR products were amplified from thymus cDNA
as follows: PCR products were generated
by using either Herculase (Stratagene) or Roche Taq polymerase (Roche
Diagnostics, Indianapolis, Ind, USA). Reactions with Herculase were 25 μL, consisting of 100 ng cDNA, 0.5 μL of Herculase polymerase, 2.5 μL of the supplied buffer, 0.5 μL of a mix of 10 mM each dNTP, and 2 μL each 5 μM primer. Amplification was carried out in a PTC-200
Peltier Thermal Cycler (Bio-Rad, Hercules, Calif, USA) with the following conditions:
95°C for 3 minutes, 35 cycles of 95°C for 30 seconds, 60°C for 30 seconds, 72°C for
6 minutes, and a final step of 72°C for 7 minutes.
Reactions with Roche polymerase were 20 μL, consisting of 100 ng cDNA, 0.1 μL Roche Taq polymerase, 2.0 μL of the supplied buffer, 0.5 μL of a mix of 10 mM each dNTP, and 2 μL each 5 μM primer.
Reactions were carried out with the following conditions: 94°C for 3
minutes, 35 cycles of 94°C for 45 seconds, 60°C for 45 seconds, 72°C for 2 minutes, and a final
step of 72°C for 7 minutes. PCR products
were cloned into pCRII with the TOPO-TA cloning kit (Invitrogen), sequenced
using ABI BigDye v3.1 (Applied Biosystems, Foster City, Calif, USA), and analyzed on an
ABI 3730XL sequencer (Applied Biosystems) at the University of Washington
Biochemistry Sequencing Core in Seattle, WA. 5′ and 3′ RACE (5′ and 3′, Rapid Amplification of cDNA Ends) was carried out with a
Marathon cDNA Amplification kit (K1802-1, Clontech, Palo Alto, Calif, USA)
using the protocol provided. Plasmids
were transformed into XL1Blue (Stratagene) by electroporation of Top10 cells
(Invitrogen) according to the protocol supplied with the cells. Plasmids were purified by using GenElute
Plasmid Maxiprep Kit (Sigma, St. Louis, Mo, USA) or Plasmid Maxi Kit
(Qiagen). GenBank accession numbers of
the cloned genes and of RACE products are DQ125335–DQ125353.
2.5. Quantitative RT-PCR
RNA was
collected from whole tissue, isolated using a Qiaqen RNeasy minikit (Valencia, Calif, USA),
and aliquoted to minimize degradation from freezing/thawing. Quantitative real time polymerase chain
reaction (qRT-PCR) was performed on anMx4000 Multiplex QPCR System (Stratagene) in duplex reactions with rat cyclophilin (NM_017101) as an
internal control. Samples were run in
triplicate using 100 ng of total RNA or 5 ng of polyA+ RNA. Twenty-five μL reactions were run using a Brilliant Single-Step qRT-PCR Kit
(2.5 μL 10x core
RT-PCR buffer, 5.5 mM MgCl2, 300 nM each primer, 200 nM each probe,
0.3 mM dNTP, 75 nM passive reference dye, 1.6 units Stratascript RT, 2 units
SureStart Taq DNA-polymerase).
The PCR cycling conditions were as follows: 45°C for 30 minutes, 95°C for 10
minutes, and 40 cycles of 95°C for 30 seconds, 60°C for 1 minute. Probes were positioned in the 3′ regions of
the transcripts where there is more variation between the different Gimap genes and subjected to BLAST
alignment to ensure specificity. The
primers and probes used for each gene are listed in Table 1. Primers were obtained from Integrated DNA
Technologies (Coralville, Iowa, USA)
or Qiagen Operon (Valencia, Calif, USA). Fluorescently labeled probes were obtained
from Integrated DNA Technologies.
Representative qRT-PCR products for each gene, from each tissue, were
run on an agarose gel to check for primer pair binding specificity. Each assay was also optimized and validated
with serial dilutions of RNA to produce a standard curve that was then
translated into a reaction efficiency, or specificity, of each Gimap gene assay. Results from each
assay were validated and normalized against cyclophilin. The standard curves, multiplexed with
cyclophilin, showed the following reaction efficiencies: Gimap8: 90%±2SD, Gimap7:
87%±4 SD, Gimap4: 92%±2 SD, Gimap6: 94%±3 SD, Gimap9:
98%±7SD, Gimap1: 100%±11 SD, Gimap5: 88%±6 SD, Lr8:
93%±4 SD, and cyclophilin: 90%±6 SD.
Probes and primers used in qRT-PCR.
Primer name
Primer sequence 5′ to 3′
Gimap8-f
CCAGGAGACCCAGGTGAAAG
Gimap8-r
AGTTGAATGCTCATCATAGCTCCTT
Gimap8-p
6FAM-TCTGTTGACAATAGCCAATGATCTCA-BHQ1
Gimap9-f
AGGAACGGCAGAGCCTACTTT
Gimap9-r
CCACTAGACATTGGTTCAGCTTCTTA
Gimap9-p
6FAM-CTGACAGGATATATAAGGACA-MGBQ
Gimap4-f
AACATGCCGTACAGAGCTCACA
Gimap4-r
AGTGGCACCATTAGAAGGCAAA
Gimap4-p
6FAM-CCATGACACACCCACTCCAACAGGG-BHQ1
Gimap6-f
TGGATGCTCTGGATGTTGCA
Gimap6-r
TCCTGCTCATCCCCTTGTG
Gimap6-p
6FAM-TTGTTGAAGCCACAATGGCGTCTCTCA-BHQ1
Gimap7-f
GGACTCAGTGTCAGGCTCCAA
Gimap7-r
CGGGAGGACAGGCTAGCATA
Gimap7-p
6FAM-CTGGATCACACTTGGCGCTCAGCTC-BHQ1
Gimap1-f
AGAGGCGGACCAGGTTCCTA
Gimap1-r
CCTCCAGCCCTGCCTGTAG
Gimap1-p
6FAM-TTCTGCCATCTCCACAGCCCA-BHQ1
Gimap5-f
CATGTTAGGGAAGCTCAGTC
Gimap5-r
GAAGGGTTCTACTGTGTCTCA
Gimap5-p
6FAM-TTTCACTATCATTTGACTCCTGTGCA-BHQ1
Gimap3-f
CCACAGGGAGTGTAGACCTTGAA
Gimap3-r
CTGCTGTTTCCGAATCCAGTTT
Gimap3-p
6FAM-ATCCTCCAGCGTCCAC-MGBQ
Lr8-f
GCCTCTGGTTGTGCCTTCTG
Lr8-r
CCCTGTCCCATCTCATGGAT
Lr8-p
6FAM-CCCACTCCAGCCAAAATTGCCACA-BHQ1
Cyc-f
CACCGTGTTCTTCGACAT
Cyc-r
TTTCTGCTGTCTTTGGAACT
Cyc-p
HEX-CTGCTTCGAGCTGTTTGCAGAC-BHQ1
Probes and primers were
designed to bind near the 3′ end of the transcripts. f is forward primer, r is reverse primer, p
is probe, 6FAM is 6-carboxyfluorescein, HEX
is hexachlorofluorescein, and BHQ1 is black
hole quencher 1.
2.6. Statistical Analysis
Three
DR.+/+ rats from different litters were used to determine the
expression of Gimap genes in
mesenteric lymph node, thymus, spleen, bone marrow, and kidney. To compare Gimap and Lr8 gene
expression across multiple tissues, data was first normalized to cyclophilin
then scaled and expressed as a percentage of DR.+/+Gimap5 mesenteric lymph node (MLN), the highest expressing gene
overall. For analysis of Gimap expression in DR.lyp/lyp, DR.lyp/+, and DR.+/+ rat thymus, spleen, and mesenteric lymph node,
15 rats (5 rats per genotype) were used from 5 litters consisting of 1
rat genotype from each litter.
Mesenteric lymph node data for 1 litter was missing leaving 12 rats from
4 litters for analysis. Comparisons from
bone marrow and kidney are not shown due to very low expression and high error
in these tissues. Pairwise comparisons
of the individual ratios were carried out using linear mixed effects models in
S-PLUS (Insightful Corp., Seattle,
Wash, USA) with a random intercept for
each litter. A conditional F-test was implemented to test the
significance of terms in the fixed effects models. A two-tail test with a P-value <.05 was
judged as significant.
2.7. Bioinformatics
Predicted
protein sequences were aligned using T-coffee (http://www.ch.embnet.org/software/TCoffee.html). Structure and topology of proteins were
defined using HMMTOP (http://www.ensim.hu./hmmtop/index.html)
or Protein Predict (http://cubic.bioc.columbia.edu/pp/). Subcellular locations were predicted using
PSORT (http://psort.nibb.ac.jp/form2.html). The
nomenclature used in this paper follows the official names determined by the
rat nomenclature committee (Lois J. Maltais, Mouse Genome Database (MGD), Mouse
Genome Informatics Web Site, The Jackson Laboratory, Bar Harbor, Maine,
http://www.informatics.jax.org/) and is different from previous publications [2, 3, 18, 19].
3. Results3.1. cDNA Cloning and Sequencing of Gimap8,
Gimap9, Gimap4, Gimap6, and Gimap7 in DR.+/+ and DR.lyp/lyp Rats
Gimap8, Gimap9, Gimap4, Gimap6, and Gimap7 (in the order as they appear on the chromosome) are located
outside the lymphopenia critical interval (Figure 1). Sequence analysis of thymus cDNA encoding Gimap4 showed three single nucleotide polymorphisms (SNPs) at positions 216, 510, and 618, relative to
the ATG start site, and two nucleotides deleted at position 922-923 in DR.lyp/lyp rats as compared to
DR.+/+ rats (Table 2). The
first three base pair substitutions resulted in synonymous amino acid changes
in the hypothetical protein sequence, while the deletion resulted in a
frameshift mutation in the last three predicted amino acid residues and
eliminated the normal stop codon at position 311. 3′ RACE from DR.lyp/lyp thymus cDNA showed that the reading frame
continued for other 21 amino acids before generating a new stop codon (Table
2). This same frameshift mutation was
also identified in F344/Rhw (nonlymphopenic) rats, which were used in the
positional cloning of lymphopenia (Table 2).
One nucleotide substitution was identified in Gimap7 at position
603, relative to the ATG start site, between DR.+/+ and DR.lyp/lyp that resulted in a synonymous
amino acid change in the hypothetical protein sequence (Table 2). No SNPs were found in the coding sequences of Gimap6, Gimap8, and Gimap9.
Gimap family thymus cDNA sequencing in
DR.+/+
and
DR.lyp/lyp
rats.
Gene name
Location (bp)
RefSeq identifier
mRNA position
DR.+/+
DR.lyp/lyp
F344
A.A Change
Genbank accession #
Gimap8
76738163
NM_001033923
−96
C
T
5′ UTR
DQ125335-36
−11
T
C
5′ UTR
Gimap9
76765555
NM_001008398
928
C
T
3′ UTR
DQ125337-38
D4Rhw2
76.77
Gimap4
76777679
NM_173153
216
A
G
A
G 72 G (Synonymous change)
DQ125339-40
510
G
A
G
T 170 T (Synonymous change)
618
G
A
G
L 206 L (Synonymous change)
922-923
TA
—
—
YLN*
308
LELIIKAWEIASFIFNQFMRD*
Gimap6
76794903
NM_001011968
No SNPs
DQ125342-43
Gimap7
76812445
NM_001024328
603
G
A
V 201 V (Synonymous change)
DQ125348-49
D4Rhw6
76.82
Gimap1
76829536
NM_001034849
752
T
C
M 251 T
DQ125350-51
Gimap5
76836521
NM_145680
252
C
—
IFESKIQNQDMDKDIGNCY…
DQ125352-53
85
SSSQRSRTKTWTRTLGTAT*
523
C
T
L 175 -
IIsnp3
77.16
mRNA position is relative to the ATG start site. UTR is untranslated region.
Expanded map of Gimap interval in human, mouse, and rat.Gimap family orthology in human, mouse, and rat is shown along with
an expanded map of the 2 Mb of DP DNA in the congenic DR.lyp rat line. The 33 Kb
lymphopenia critical interval is indicated between the SSLP markers D4Rhw6 and
IIsnp3. Ian aliases are in
parentheses underneath the corresponding Gimap name.
3.2. cDNA Cloning and Sequencing of Gimap1 and Gimap3 in DR.+/+ and DR.lyp/lyp Rats
Gimap1 and Gimap3 are located inside the
lymphopenia critical interval (Figure 1).
Sequence analysis of thymic cDNA showed a single SNP in the coding
sequence of Gimap1 at nucleotide
position 752, relative to the ATG start site, that produced an amino acid
change in DR.lyp/lyp rats
as compared to the DR.+/+ (Table 2). The SNP produced a methionine (M) to
threonine (T) substitution at amino acid 251, which is located near the
C-terminus and is not in any of the predicted GTP binding domains. Sorting intolerant from tolerant (SIFT)
analysis (http://blocks.fhcrc.org/sift/SIFT.html) predicted the T substitution
to be tolerated at this position and did not predict to affect protein function.
Gimap3 is not annotated in the rat genome sequence. Genomic sequencing of the putative
ortholog of mouse Gimap3 from base
pair positions 76,846,091 to 76,852,162 on RNO 4 (the orthologous DNA interval
to mouse Gimap3) in DR.+/+ and DR.lyp/lyp rats
revealed repetitive single or dinucleotide repeats throughout the region that likely
resulted in early termination of the sequencing reactions. As such, no specific PCR products could be
generated. Attempts were also made to
amplify Gimap3 from DR.+/+ and DR.lyp/lyp rat thymus
cDNA; however, again, no specific PCR products were obtained. Comparative analysis of the Brown Norway
(BN/Hsdmcwi) database sequence, available at the University of California Santa
Cruz (UCSC; Nov. 2004 assembly), with the mouse Gimap3 database sequence (UCSC) failed to establish an open reading
frame. The multiple repetitive elements added additional difficulty in locating
potential exons or transcripts. No rat
EST evidence could be found in the region orthologous to mouse Gimap3 and in human; GIMAP3 is annotated as a pseudogene.
Lastly, no evidence of a Gimap3 transcript was found in northern blots of DR.+/+ and DR.lyp/lyp or from qRT-PCR of
DR.+/+ rat thymus or spleen (data not shown). Therefore, Gimap3 is likely a pseudogene in rat.
3.3. Predicted Protein Alignment
Alignment of the Gimap family predicted protein sequences in the DR.+/+ rat (Figure 2) showed
predicted GTP binding domains and conserved box characteristics for all of the
Gimap proteins with the most divergent regions located near the C-terminal
ends. Gimap1 and Gimap5 are predicted to contain transmembrane domains while Gimap4 and
Gimap9 are predicted to contain coiled coil domains. Gimap8, Gimap7, and Gimap6
are predicted to have neither transmembrane nor coiled coil domains. Gimap8 was larger than the other Gimap
proteins, containing 688 amino acids and three repeated GTP binding domains
(Figure 2).
Alignment of predicted Gimap protein
sequences in the DR.+/+ rat. T-coffee predicted protein alignment from
cloned cDNA is shown. Gimap8 is divided into three separate
sequences (with the amino acid numbers indicated by each sequence). Shading indicates the GTP binding domain
consensus regions (GTP) and the conserved domain (Conserved Box). The HMMTOP predicted transmembrane domain sequences for Gimap1 and Gimap5 and the coiled coil domains for Gimap4 and Gimap9 are underlined.
3.4. Gimap Expression Pattern across Multiple Tissues
The relative expression levels of the Gimap genes in mesenteric lymph node,
thymus, spleen, bone marrow, and kidney were determined in the DR.+/+ rat (Figure 3). All of the Gimap genes expressed more robustly in
the mesenteric lymph nodes, thymus, and spleen as compared to bone marrow and
kidney (P<.0001). In the mesenteric
lymph node, Gimap4, Gimap5, and Gimap8 were expressed significantly
higher than Gimap9 (P<.0001)
while in kidney, Gimap4 and Gimap8 were expressed significantly
higher than Gimap1 and Gimap9 (P<.001) (Figure 3). No significant expression differences were
detected between any of the Gimap genes (Gimap8, 9, 4, 6, 7, 1, and 5) in thymus, spleen, and bone marrow. Overall, Lr8, a gene unassociated with the Gimap family but also within the 2 Mb of DP DNA in the congenic DR.lyp/lyp rat line, expressed
predominantly in the spleen, an expression pattern unique relative to the Gimap family.
Tissue specific Gimap expression. The mean ± standard deviation is shown
for DR.+/+ (n=3) Gimap gene expression. To compare Gimap gene expression across multiple tissues, data was first
normalized to cyclophilin then scaled and expressed as a percentage of DR.+/+Gimap5 mesenteric lymph node (MLN), the
highest expressing gene overall. Genes
appear in the order at which they appear on rat chromosome 4. Tissues appear in the following order per
gene: MLN (dots), thymus (white), spleen (hash marks), bone marrow (black), and
kidney (stripes). Significance is
represented as follows: *** is P<.0001 and ** is P<.001.
3.5. Gimap Expression in DR.lyp/lyp and DR.+/+ Thymus, Spleen, and Mesenteric Lymph Node
In thymus, expression of Gimap4, Gimap9, Gimap1, and Gimap5 was significantly decreased in DR.lyp/lyp rats as compared to DR.+/+ (Figure 4). In contrast, Gimap7 expression in thymus was higher in DR.lyp/lyp as compared to DR.+/+ while Gimap8, Gimap6, and Lr8 showed no differential
expression. Expression of all of the Gimap genes (8, 9, 4, 6, 7, 1, and 5)
was reduced in DR.lyp/lyp rat spleen and mesenteric lymph node as compared to DR.+/+ (Figure 4). We observed the same expression
pattern whether the data were normalized to cyclophilin or to total RNA (data
not shown). Data from bone marrow and
kidney is not shown due to the very low expression in these tissues. The low expression observed in these tissues
is not due to RNA degradation, but rather to the low mRNA levels relative to
cyclophilin levels.
Gimap gene
expression in the DR.+/+ and DR.lyp/lyp rats. The mean ± standard deviation is shown for
DR.+/+ and DR.lyp/lyp rat Gimap gene expression in thymus (n=5),
spleen (n=5) and mesenteric lymph node (MLN) (n=4) after normalization to
cyclophilin. Black columns represent
DR.+/+ and grey hatched columns represent DR.lyp/lyp. Data is expressed
as a percentage of DR.+/+. Significant differences are follows; * for
P<.05, ** for P<.01, *** for P<.001. Genes appear in the order at which they
appear on rat chromosome 4. The average Gimap expression in DR.+/+ rat bone marrow and kidney s is shown in Figure 3.
4. Discussion
While the frameshift mutation in Gimap5 is likely necessary and
sufficient for lymphopenia, the possibility remains that additional mutation(s)
in the Gimap family may contribute to
the development of lymphopenia, spontaneous T1D, or both in the DR.lyp/lyp rat. Aside from Gimap5, only Gimap1 and Gimap3 could potentially play a role in
the development of lymphopenia, as they are the only remaining genes located
within the 33 Mb interval critical for lymphopenia between D4Rhw6 and
IIsnp3. The methionine to threonine base
pair substitution at amino acid position 251 in Gimap1 is not located in any of the predicted GTP binding domains and
SIFT analysis predicted that the mutation is not likely to alter normal Gimap1
protein function. Furthermore, the DR
amino acid at position 251 is not conserved across species; human GIMAP1 has a
valine at this same position [3]. Lastly, no Gimap3 transcript could be found and no open reading frame could be
identified. We suspect that this region
of the rat genome does not code for a protein, which is similar to the human
GIMAP3 pseudogene [3] and unlike mouse Gimap3 [15]. Therefore, the sequence analysis of Gimap1 and Gimap3 supports the hypothesis that Gimap5 is the cause of lymphopenia in the DR.lyp/lyp rat. In
addition, the sequence data from all of the remaining Gimap family members suggest that these genes are not likely to play a
role in the onset of T1D diabetes. We
cannot however exclude the possibility that there are mutations outside of the
coding regions, such as in transcription factor binding sites or other
regulatory sites, that play a role in the regulation of Gimap gene expression and/or the onset of T1D in the DR.lyp/lyp rat.
While we can exclude the
involvement of the members of the Gimap family proximal to D4Rhw6 (Gimap8, Gimap9, Gimap4, Gimap6, and Gimap7)
in the development of lymphopenia, we cannot exclude that they may play a role
in the development of T1D. Coding
sequence analysis of these family members revealed that only Gimap4 had genetic differences,
specifically a two-base pair deletion, that would result in a nonsynonymous
amino acid change between the nondiabetic DR.+/+ and the diabetes
susceptible DR.lyp/lyp (Table 2). Although the effect of this
variation is unknown, we did discover this same deletion in the
nonlymphopenic, diabetes resistant F344 rat.
F344 DNA introgressed through this interval on the DR.lyp/lyp background protects
from onset of T1D [4] suggesting that the deletion
mutation in Gimap4 is not
deleterious. In addition, the predicted
protein sequences of both human (AK001972) and mouse (NP_778155.2) Gimap4 show
that the 23 C-terminal amino acids are similar to those of DR.lyp/lyp (data not
shown). It is therefore unlikely that
the Gimap4 two-base pair deletion
mutation in the DR.lyp/lyp rat is functionally relevant to
development of T1D or lymphopenia, rather it is likely an additional natural
isoform [20].
All of the Gimap genes were predominantly expressed in organs of the immune
system: mesenteric lymph node, thymus, and spleen, consistent with previous
findings of a role of the Gimap gene
family in lymphocyte development [21]. Interestingly, there was an overall reduction
in expression of all seven Gimap genes in DR.lyp/lyp rat
spleen and mesenteric lymph node and four (Gimap4, Gimap9, Gimap1, and Gimap5) of
the seven genes in DR.lyp/lyp rat thymus. In contrast, Lr8, a gene unrelated to the Gimap family
located 69 Kb downstream of Gimap5, (Figure 1) [22, 23] showed no differential
expression between DR.+/+ and DR.lyp/lyp. It is not clear why Gimap5 transcript levels are reduced as the single cytosine residue
deletion results in a frameshift mutation and a premature truncation in the
protein. One hypothesis is that during
protein synthesis, the incomplete (truncated) protein may destabilize the
RNA/protein complexes and cause mRNA degradation [24, 25]. Another hypothesis for reduction in DR.lyp/lyp rat Gimap gene transcripts is a difference
in organ composition from those of DR.+/+ rats. Reduced T cells numbers in DR.lyp/lyp rats could lead to a
difference in cellular composition and may explain the lower observed
expression of all of the Gimap genes.
As the function of Gimap proteins remains rather poorly defined, it would be a
useful addendum if in vitro knockdown experiments were designed to test the
functional changes that might derive from reduced expression of Gimap5. These types of experiments could
determine if the mutation is significant in functional terms or if the altered
expression is the most critical feature.
The Gimap gene family is conserved throughout evolution from plants to
humans [3]. Members of the Gimap gene family are implicated in a variety of basic cellular
processes. These include protection
against plant pathogens [26] and okadaic acid and gamma
radiation [16]. Gimap family members have also been found to be important for T cell development [27], B cell activation [28], B cell malignancy [29], and apoptosis [8, 30]. In addition, Gimap5 deficient mice have been shown to have impaired maturation
and survival of CD4 and CD8 positive T cells [13].
In conclusion, positional cloning of the
lymphopenia gene in the spontaneously T1D prone BB DP rat revealed a frameshift
mutation in the GTPase Immune Associated Protein Gimap5 [2, 6]. Our coding sequence analysis of the remaining
members of the Gimap family revealed that Gimap4 and Gimap1 each had coding variation between DR.+/+ and DR.lyp/lyp. However, the amino acid differences do not
appear to have functional effects substantiating the Gimap5 frameshift mutation as the cause of lymphopenia. Quantitative real time PCR analysis showed a
reduction in expression of all seven Gimap genes in DR.lyp/lyp spleen
and mesenteric lymph nodes when compared to DR.+/+ while only four, Gimap1,
Gimap4, Gimap5, and Gimap9, were reduced in thymus. Further understanding of the nature of the Gimap family will aid in our goal of
characterizing the pathways involved in the development of lymphopenia and T1D.
Acknowledgments
This work was supported by the
National Institutes of Health (AI42380) and the Molecular and Genetics Core
(E. A. R., B. V., J. L. H., and M. R. P.) of the University of Washington
Diabetes
and Endocrinology Research Center
(DK17047), a Junior Faculty Award (D. H. M), and a Mentor Based Postdoctoral
Fellowship Award (Å. L.) from the American Diabetes Association.
MarkholstH.EastmanS.WilsonD.AndreasenB. E.LernmarkÅ.Diabetes segregates as a single locus in crosses between inbred BB rats prone or resistant to diabetes1991174129730010.1084/jem.174.1.297MacMurrayA. J.MoralejoD. H.KwitekA. E.Lymphopenia in the BB rat model of type 1 diabetes is due to a mutation in a novel immune-associated nucleotide (Ian)-related gene20021271029103910.1101/gr.412702KrückenJ.kruecken@uni-duesseldorf.deSchroetelR. M. U.MüllerI. U.Comparative analysis of the human gimap gene cluster encoding a novel GTPase family20043411-229130410.1016/j.gene.2004.07.005FullerJ. M.jfuller@u.washington.eduKwitekA. E.HawkinsT. J.Introgression of F344 rat genomic DNA on BB rat chromosome 4 generates diabetes-resistant lymphopenic BB rats200655123351335710.2337/db06-0715MoralejoD. H.moralejo@u.washington.eduParkH. A.SperosS. J.Genetic dissection of lymphopenia from autoimmunity by introgression of mutated Ian5 gene onto the F344 rat200321431532410.1016/S0896-8411(03)00138-0HornumL.RmerJ.MarkholstH.hmar@hagedorn.dkThe diabetes-prone BB rat carries a frameshift mutation in Ian4, a positional candidate of
Iddm120025161972197910.2337/diabetes.51.6.1972MichalkiewiczM.mmichalk@mcw.eduMichalkiewiczT.EttingerR. A.Transgenic rescue demonstrates involvement of the Ian5 gene in T cell development in the rat200419222823210.1152/physiolgenomics.00126.2004PandarpurkarM.Wilson-FritchL.CorveraS.Ian4 is required for mitochondrial integrity and T cell survival200310018103821038710.1073/pnas.1832170100IlangumaranS.Forand-BoulericeM.BousquetS. M.Loss of GIMAP5 (GTPase of immunity-associated nucleotide binding protein 5) impairs calcium signaling in rat T lymphocytes20094661256125910.1016/j.molimm.2008.09.031DalbergU.MarkholstH.hmar@hagedorn.dkHornumL.Both Gimap5 and the diabetogenic BBDP allele of Gimap5 induce apoptosis in T cells200719444745310.1093/intimm/dxm009KeitaM.LeblancC.AndrewsD.RamanathanS.Sheela.Ramanathan@Usherbrooke.caGIMAP5 regulates mitochondrial integrity from a distinct subcellular compartment2007361248148610.1016/j.bbrc.2007.07.048KupferR.LangJ.Williams-SkippC.NelsonM.BellgrauD.ScheinmanR. I.Loss of a gimap/ian gene leads to activation of NF-κB through a MAPK-dependent pathway200744447948710.1016/j.molimm.2006.02.014SchulteisR. D.ChuH.DaiX.Impaired survival of peripheral T cells, disrupted NK/NKT cell development, and liver failure in mice lacking Gimap52008112134905491410.1182/blood-2008-03-146555StammO.KrückenJ.Schmitt-WredeH.-P.BentenW. P. M.WunderlichF.frank.wunderlich@uni-duesseldorf.deHuman ortholog to mouse gene imap38 encoding an ER-localizable G-protein belongs to a gene family clustered on chromosome 7q32-3620022821-215916710.1016/S0378-1119(01)00837-XDahéronL.ZenzT.SiracusaL. D.BrennerC.CalabrettaB.b_calabretta@lac.jci.tju.eduMolecular cloning of Ian4: a BCR/ABL-induced gene that encodes an outer membrane mitochondrial protein with GTP-binding activity20012961308131610.1093/nar/29.6.1308SandalT.AumoL.HedinL.GjertsenB. T.DøskelandS. O.stein.doskeland@iac.uib.noIrod/Ian5: an inhibitor of γ-radiation- and okadaic acid-induced apoptosis20031483292330410.1091/mbc.E02-10-0700BiegS.KoikeG.JiangJ.Genetic isolation of iddm 1 on chromosome 4 in the biobreeding (BB) rat19989432432610.1007/s003359900759KrückenJ.kruecken@uni-duesseldorf.deEpeM.BentenW. P. M.FalkenrothN.WunderlichF.Malaria-suppressible expression of the anti-apoptotic triple GTPase mGIMAP8200596233934810.1002/jcb.20552NittaT.NasreenM.SeikeT.IAN family critically regulates survival and development of T lymphocytes200644, article e10311310.1371/journal.pbio.0040103CarterC.DionC.SchnellS.A natural hypomorphic variant of the apoptosis regulator Gimap4/IAN12007179317841795FilénJ.-J.FiLénS.MoulderR.Quantitative proteomics reveals GIMAP family proteins 1 and 4 to be differentially regulated during human T helper cell differentiation200981324410.1074/mcp.M800139-MCP200LurtonJ.RoseT. M.RaghuG.NarayananA. S.Isolation of a gene product expressed by a subpopulation of human lung fibroblasts by differential display1999202327331NakajimaH.TakenakaM.KaimoriJ.-Y.Gene expression profile of renal proximal tubules regulated by proteinuria20026151577158710.1046/j.1523-1755.2002.00300.xFrischmeyerP. A.DietzH. C.hdietz@welchlink.welch.jhu.eduNonsense-mediated mRNA decay in health and disease19998101893190010.1093/hmg/8.10.1893MendellJ. T.SharifiN. A.MeyersJ. L.Martinez-MurilloF.DietzH. C.hdietz@jhmi.eduNonsense surveillance regulates expression of diverse classes of mammalian transcripts and mutes genomic noise200436101073107810.1038/ng1429ReuberT. L.AusubelF. M.Isolation of arabidopsis genes that differentiate between resistance responses mediated by the RPS2 and RPM1 disease resistance genes19968224124910.1105/tpc.8.2.241PoirierG. M. C.poirigmc@novell5.bham.ac.ukAndersonG.HuvarA.Immune-associated nucleotide-1 (IAN-1) is a thymic selection marker and defines a novel gene family conserved in plants1999163949604969CambotM.ArestaS.Kahn-PerlèsB.de GunzburgJ.RoméoP.-H.romeo@cochin.inserm.frHuman immune associated nucleotide 1: a member of a new guanosine triphosphatase family expressed in resting T and B cells20029993293330110.1182/blood.V99.9.3293ZenzT.thorsten.zenz@medizin.uni-ulm.deRoessnerA.ThomasA.hlan5: the human ortholog to the rat lan4/lddm1/lyp is a new member of the Ian family that is overexpressed in B-cell lymphoid malignancies20045210911610.1038/sj.gene.6364044LangJ. A.KominskiD.BellgrauD.ScheinmanR. I.robert.scheinman@uchsc.eduPartial activation precedes apoptotic death in T cells harboring an IAN gene mutation20043492396240610.1002/eji.200324751