Colorectal cancer patients with diabetes had the high risks of total mortality. High expression of MSX2 is related to development of diabetes. There are few reports about the clinical implications and function of MSX2 in colorectal cancer (CRC). The purpose of this study is to investigate the relationship between the expression of MSX2 and clinical relevance and discover the possible mechanism of MSX2 in the development of CRC. Compared with adjacent tissues, the expression of MSX2 was higher in tumor tissues in both mRNA and protein levels (
CRC is the third most commonly diagnosed cancer (1,360,602 new cases) and the fourth cause of cancer mortality (694,000 deaths) worldwide in 2012 [
Previous studies have indicated that the incidence of colorectal cancer is closely related to genetic factors [
Muscle segment homeobox genes 2 (MSX2) plays an important role in the development of multiple organs. MSX2-deficient mice showed reduced proliferation of osteoprogenitors, the defects of skull ossification, and persistent calvarial foramen [
Increasing evidence indicated that MSX2 was involved in the development of tumor. Clinical studies showed high MSX2 expression was associated with short survival time in prostate [
136 pairs of CRC tumor and adjacent tissues were collected from Cancer Hospital, Chinese Academy of Medical Sciences (CAMS), Beijing, China, from March 1, 2011, to November 30, 2011. CRC was confirmed by pathological histology. This research was approved by the medical ethics committee of Cancer Hospital, CAMS, and informed consent was obtained from all patients. After surgery, specimens were freezed immediately in liquid nitrogen within 30 min and then transferred to −80°C refrigerator for later use. Following up was finished in September 30, 2015. Overall survival time was calculated from surgery to death or last observation for surviving patients.
The total tissue mRNA was extracted according to standard protocol of the Oligotex mRNA Mini Kit (Qiagen, Hilden, Germany) and then used for reverse transcription by the PrimeScript™ RT Master Mix Kit (Takara, Shiga, Japan). MSX2 and
MSX2-F (5′-3′): GGAGCGGCGTGGATGCAGGAA
MSX2-R (5′-3′) AAGCACAGGTCTATGGAACGG;
Total protein was extracted from patient specimens by RIPA buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1% Triton-X100, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with a cocktail of protease inhibitors (Sigma). Protein concentration was determined by the method of bicinchoninic acid assay (BCA) (Thermo Scientific). 30
After the surgery, specimens were fixed in 10% formalin, and paraffin-embedded tissues (4
The human CRC cell lines HCT-8, HCT-116, LoVo, and SW480 were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). All the cell lines were maintained in RPMI 1640 Medium (Hyclone, Logan, UT, USA) with 10% fetal bovine serum (Sigma, St. Louis, MO, USA), 100 U/mL penicillin, and 100
For knockdown of MSX2 expression, specific MSX2 small interfering RNA (siRNA), and negative control (NC) sequences were designed and synthesized by Ribobio Co. Ltd. (Ribobio, Guangzhou, China). The oligonucleotide sequences were shown as follows: MSX2 siRNA sense sequence (5′-UGAGGAAACACAAGACCAAdTdT-3′); antisense sequence (5′-UGAGGAAACACAAGACCAAdTdT-3′). An unrelated scrambled siRNA was served as a negative control. The cell lines were transfected with a final concentration of 50 nM siRNA according to manual of the siRNA transfection kit (Ribobio), and function assays were performed after 48 h transfection.
Cancer cells were transfected with small interfering negative control RNA (si-NC) or specific MSX2 small interfering RNA (si-MSX2), respectively, and harvested after 48 h transfection. Cell proliferation assays were detected by MTT. Transfected cells (1 × 103 cells in 100
For apoptosis detection, transfected cells were staining with 7AAD and Annexin V-PE (Bio-Box, Nanjing, China). For cell cycle detection, transfected cells were fixed in 70% ethanol overnight at 4°C and then washed with phosphate buffered saline (PBS). After washing, cells were resuspended in 500
Invasion and migration assays were performed using 24-well chambers (pore size 8
Statistical analyses were performed by IBM SPSS Statistics 19.0 (SPSS, Chicago, IL, USA). Pearson’s Chi-square test was used to analyze the correlation between MSX2 expression and clinicopathological parameters. The relationship between the overall survival rate and the MSX2 expression difference was evaluated by Kaplan-Meier method with log-rank test. The difference between groups was determined by two-tailed
To identify potential CRC related genes, we evaluated MSX2 expression in primary CRC tissues and adjacent tissues by qRT-PCR, IHC, and western blotting. In 136 CRC patients, the expression of MSX2 mRNA in tumor tissues had a higher level than that in adjacent tissues (ΔCt value −
The expression of MSX2 in CRC tumor tissue (T) and adjacent tissue (N). (a) The MSX2 expression of T and N in 136 CRC patients was determined by qRT-PCR (
To determine the clinical significance of MSX2 in CRC, the relationship between the mRNA expression of MSX2 and clinical characteristics was investigated by Chi-squared test. Since the median ΔCt of MSX2 in tumor tissues was 8.50, the 136 patients were divided into high and low expression groups according to ΔCt value less than 8.5 or greater than 8.5, respectively. The Chi-squared test showed that high MSX2 mRNA expression was associated with tumor locus (
Relationship between the MSX2 expression and clinicopathological characteristics of CRC.
Characteristics | Num | MSX2 expression | | | |
---|---|---|---|---|---|
Low | High | ||||
Gender | 0.275 | 0.600 | |||
Male | 81 | 39 | 42 | ||
Female | 55 | 29 | 26 | ||
Age (years) | 2.383 | 0.123 | |||
<60 | 67 | 38 | 29 | ||
≥60 | 69 | 30 | 39 | ||
Tumor locus | 5.024 | | |||
Rectum | 75 | 44 | 31 | ||
Colon | 61 | 24 | 37 | ||
Tumor size | 4.239 | | |||
<4.5 cm | 70 | 39 | 27 | ||
≥4.5 cm | 66 | 29 | 41 | ||
Tumour differentiation | 0.762 | 0.683 | |||
Well | 17 | 10 | 7 | ||
Moderate | 101 | 50 | 51 | ||
Poor | 18 | 8 | 10 | ||
Clinical stage | 24.846 | < | |||
I | 27 | 20 | 7 | ||
II | 29 | 20 | 9 | ||
III | 65 | 25 | 40 | ||
IV | 15 | 3 | 12 | ||
Tumor invasion | 8.815 | | |||
T1 + T2 | 28 | 8 | 0 | ||
T3 + T4 | 108 | 13 | 7 | ||
Lymphatic metastasis | 14.576 | | |||
L0 | 58 | 40 | 18 | ||
L1 | 40 | 14 | 26 | ||
L2 | 38 | 14 | 24 | ||
Distant metastasis | 4.533 | | |||
Yes | 16 | 4 | 12 | ||
No | 120 | 64 | 56 |
Kaplan-Meier survival analysis and log-rank test for overall survival of 136 CRC patients according to MSX2 mRNA expression level. Higher MSX2 expression predicated a shorter survival time (log rank,
The above clinical analysis indicated that high MSX2 expression was associated with the tumor size and clinical stage, which prompted us to explore the function of MSX2 in CRC cells. We examined the expression of MSX2 in different CRC cell lines (HCT-8, HCT-116, SW480, and LoVo) by western blotting. In HCT-8 and HCT-116 cell lines, we observed high expression of MSX2 (Figure
Knockdown of MSX2 expression suppressed proliferation of the CRC cell lines. (a) The expression of MSX2 was analyzed by western blotting in different CRC cell lines (SW480, HCT-8, HCT-116, and LoVo) and
Since cell proliferation was often related to the cell cycle and apoptosis, we analysed the effect of MSX2 on cell cycle distribution and the ratio of apoptotic cells by flow cytometry. Knockdown of MSX2 expression resulted in S phase cell arrest, an increase of the cell proportion in G1 phase in HCT-116 and HCT-8 (Figures
Knockdown of MSX2 expression promoted the cell cycle arrest and apoptosis of CRC cell line. HCT-8 (a, c) and HCT-116 cells (b, d) were harvested after transfection with si-MSX2 and si-NC for 48 h. (a, b) Representative histograms of cell cycle distribution detected by flow cytometry for PI-staining. The green, blue, and yellow peaks represent G1 stage, G2 stage, and S stage, respectively (left panel); data summary of the proportion of cell cycle distribution (right panel) (
The analysis of clinical samples indicated that high MSX2 expression was related to lymphatic metastasis and distant metastasis. Therefore, we performed a transwell assay to verify the function of MSX2 in regulating cell migration (chamber with no matrigel coating) and invasion (chamber with matrigel coating). The counting of the cells penetrated transwell chamber indicated that knockdown of MSX2 expression significantly decreased the abilities of migration and invasion of HCT116 and HCT-8 cell lines (Figure
Knockdown of MSX2 expression suppressed the migration and invasion of CRC cell line in vitro. Representative photomicrographs of migration (chamber uncoated with matrigel) (a) and invasion (chamber coated with matrigel) (b) of HCT-8 and HCT-16 cell lines (left panel) and data summary of the number of cells that penetrated the transwell (right panel) (
In order to verify whether MSX2 was correlated with CRC, we evaluated the expression of MSX2 in 136 CRC patients. We observed a higher expression of MSX2 in CRC tumor tissues than adjacent tissues in mRNA and protein level, which correlated with the malignancy of CRC. High expression of MSX2 was associated with the poor clinical prognosis. Our results were consistent with previous reports about prostate and pancreatic cancer. In prostate cancer, the expression of MSX2 was upregulated in the tumors with bone metastasis. The higher expression of MSX2, the poorer metastasis-free survival in patients. MSX2 was considered to be an independent prognostic factor in advanced prostate carcinoma [
Among the 136 pairs of CRC samples, 113 had significant higher expression in tumor tissues compared with corresponding adjacent tissues. Since MSX2 generally plays a regulatory role in the protein level, we evaluated the protein expression of tumor tissues with increased mRNA expression using western blotting. The result showed a consistent expression in mRNA and protein level. Another compliment experiment with 10 pairs of samples by IHC showed that 7 of which had significant high expression in tumor tissues, which further confirmed high expression of MSX2 protein in CRC. Although these results are needed to be validated in large scale CRC samples, our work provided certain enlightenment for analyzing the relationship between protein level of MSX2 expression and the clinical relevance in the future.
In order to clarify the mechanism behind the phenomenon that high MSX2 expression was correlated with poor prognosis in the CRC, we knocked down the expression of MSX2. The deficiency of MSX2 resulted in inhibition of cell proliferation, cell cycle arrest, apoptosis, and reduced migration and invasion. Since Akt signaling pathway has been reported as an important player in the development of CRC [
WNT/
The characteristics of MSX2 affecting the migration and invasion of pancreatic cancer cell were also reflected in the appearance of EMT phenotype [
Tumor microenvironment has abundant blood vessels which is an important channel for tumor nutrition and escape. Therefore, our hypothesis is that MSX2 may promote the distal metastasis of the tumor cells via vascular calcification. Previous report indicated that inflammation promoted tumor metastasis [
In summary, this is the first investigation of the correlation of MSX2 and CRC. The study demonstrated that high expression of MSX2 is associated with short survival time in CRC patients. MSX2 promoted proliferation and invasion of CRC cells through the Akt signaling pathway. Our work indicated that MSX2 may be an important prognostic marker and a potential therapeutic target in CRC, which may expand our understanding of the potential mechanism of MSX2, affecting the vascular calcification in diabetes.
The authors declare that there are no competing interests.
This work was supported by grants from the National Basic Research Program of China (Grant no. 2014CB542103), the National High-Tech R&D Program of China (863 Program 2014AA020519), National Natural Science Foundation of China (Grants nos. 81541154 and 81602576), and CAMS Innovation Fund for Medical Sciences (CIFMS) (Grant no. 2016-I2M-1-001).