Biodiversity of endophytic fungi associated with the medicinal plant
Endophytes are microbes that colonize living, internal tissues of plants without causing any immediate, overt negative effect [
The discovery of novel antimicrobial metabolites from endophytes is an important alternative to overcome the increasing levels of drug resistance by plant and human pathogens [
Isolation was carried out as described by Wang et al. [
Colonization rate (CR) was calculated as the total number of plant tissue segments infected by fungi divided by the total number of segments incubated [
Simpson’s index of diversity was calculated using formula
Shannon-Wiener diversity index was calculated using the following equation:
The test microorganisms used in this study included three bacterial strains (
The fungal fermentation was carried out using 100 mL of potato dextrose broth (PDB) in 250 mL of Erlenmeyer flask inoculated with (
The antimicrobial activity of the fermentation broth was carried out for the 35 endophytic fungal isolates. The fermented broth was sterilized by filtration with 0.22
Polymerase chain reaction was performed to amplify specifically the ITS region of the fungal genome. The fungal ITS regions, including the intervening 5.8 S gene and the flanking ITS1 and ITS2, were amplified with universal primers ITS 4 (5′TCCTCCGCTTATTGATATGC3′) and ITS 5 (5′GGAAGTAAAAGTAACAAGG3′) designed by White et al. [
The consensus sequence obtained was subjected to BLAST search to assign putative identity, designation of operational taxonomic units based on sequence similarity measures, and phylogenetic inference. It was then aligned with other sequences of endophytic and pathogenic
Endophytic fungi are known to be ubiquitous in nature and every plant species examined to date has been found colonized with fungal endophytes. It has been found that a single plant species may harbour hundreds of endophytes and may inhabit all available tissues, including leaves, petioles, stems, twigs, bark, xylem, roots, fruit, flowers, and seeds [
In the present study a total of 170 isolates of endophytic fungi were recovered from 250 samples of leaf, stem, seed, and fruit of ten
Colonization and isolation rate of endophytic fungi from different plant tissues of
Leaf (NFX) | Stem (NFS) | Seeds (NFB) | Fruit (NFT) | Total | |
---|---|---|---|---|---|
No. of samples | 100 | 50 | 50 | 50 | 250 |
No. of samples yielding fungi | 88 | 18 | 12 | 36 | 154 |
No. of isolates | 110 | 24 | 23 | 46 | 170 |
Colonization rate (CR %) | 88 | 36 | 24 | 72 | 61.6 |
Isolation rate (IR) | 1.1 | 0.48 | 0.46 | 0.92 | 0.68 |
Endophytic fungi isolated from different parts of
Endophytes | Leaf | CF (%) | Stem | CF (%) | Seed | CF (%) | Fruit | CF (%) |
---|---|---|---|---|---|---|---|---|
Ascomycetes |
||||||||
|
2 | 2 | — | — | — | — | — | — |
|
6 | 12 | 1 | 2 | — | — | 2 | 4 |
Coelomycetes | ||||||||
|
14 | 14 | 1 | 2 | 1 | 2 | 2 | 4 |
|
3 | 3 | — | — | — | — | 1 | 2 |
|
8 | 8 | 2 | 4 | 1 | 2 | 3 | 6 |
|
12 | 12 | — | — | 2 | 4 | 5 | 10 |
|
5 | 5 | 3 | 6 | — | — | — | — |
Hyphomycetes | ||||||||
|
7 | 7 | 3 | 6 | 4 | 8 | 1 | 2 |
|
2 | 2 | — | — | 2 | 4 | 4 | 8 |
|
— | — | — | — | 1 | 2 | 1 | 2 |
|
6 | 6 | 1 | 2 | 1 | 2 | — | — |
|
6 | 6 | 2 | 4 | 1 | 2 | 2 | 4 |
|
1 | 1 | — | — | — | — | — | — |
|
8 | 8 | 2 | 4 | 1 | 2 | 4 | 8 |
|
6 | 6 | 1 | 2 | 2 | 4 | 6 | 12 |
|
4 | 4 | 1 | 2 | 2 | 4 | 9 | 18 |
|
4 | 4 | — | — | — | — | 2 | 4 |
|
5 | 5 | 3 | 6 | — | — | 1 | 2 |
|
9 | 9 | 4 | 8 | 4 | 8 | 3 | 6 |
Mycelia sterilia |
||||||||
Morphotype 1 | 1 | 1 | — | — | — | — | — | — |
Morphotype 2 | 1 | 1 | — | — | — | — | — | — |
As shown in Table
Species diversity in terms of dominance, richness and evenness of endophytic fungal assemblages in different tissues of
Tissue | Total number of taxa | Total number of isolates | Simpson index (I-D) | Shannon-Wiener index (Hs) | Evenness index |
---|---|---|---|---|---|
Leaf | 20 | 110 | 0.9302 | 2.794 | 0.8175 |
Stem | 12 | 24 | 0.8958 | 2.362 | 0.8841 |
Seed | 12 | 22 | 0.8884 | 2.335 | 0.8607 |
Fruit | 15 | 46 | 0.8998 | 2.485 | 0.8002 |
The endophytic fungi were evaluated for their antimicrobial activity against some clinically significant human pathogens. The fermentation broths of 35 endophytic fungi were screened for antimicrobial activity against three pathogenic bacterial strains,
NFX 06-
NFX 01-
NFX 15-
Antimicrobial activity of the fermentation broth of endophytic fungi isolated from different parts of
Endophytic fungal taxa |
Strain no. | Microorganism tested | |||
---|---|---|---|---|---|
|
|
|
|
||
|
NFX 01 | + | − | − | + |
|
NFX 02 | + | + | − | − |
|
NFX 03 | + | − | − | − |
|
NFX 04 | ++ | + | − | − |
|
NFX 05 | + | + | + | ++ |
|
NFX 06 | +++ | +++ | +++ | +++ |
|
NFX 07 | ++ | + | + | + |
|
NFX 08 | + | + | + | ++ |
|
NFX 09 | +++ | ++ | ++ | ++ |
|
NFX 10 | + | + | + | + |
|
NFX 11 | ++ | + | − | − |
|
NFX 12 | ++ | + | + | ++ |
|
NFX 13 | ++ | ++ | ++ | +++ |
|
NFX 14 | ++ | + | + | + |
|
NFX 15 | − | − | − | − |
|
NFX 16 | + | − | − | − |
|
NFX 17 | − | − | − | − |
|
NFX 18 | + | + | − | − |
|
NFX 19 | + | − | − | − |
|
NFX 20 | ++ | ++ | ++ | +++ |
|
NFX 21 | + | − | − | − |
|
NFX 22 | ++ | + | + | + |
|
NFX 23 | +++ | +++ | +++ | +++ |
| |||||
|
NFS 01 | − | − | − | − |
|
NFS 02 | ++ | ++ | ++ | +++ |
|
NFS 03 | + | + | + | + |
| |||||
|
NFB 01 | + | + | + | + |
|
NFB 02 | ++ | ++ | ++ | +++ |
|
NFB 03 | + | + | + | ++ |
|
NFB 04 | +++ | +++ | +++ | +++ |
| |||||
|
NFT 01 | ++ | ++ | ++ | ++ |
|
NFT 02 | ++ | ++ | + | ++ |
|
NFT 03 | ++ | + | ++ | +++ |
|
NFT 04 | + | + | + | + |
|
NFT 05 | − | − | − | − |
Streptomycin | +++ | +++ | +++ | − | |
Fluconozole | − | − | − | +++ |
Colony morphology and conidia of endophytic fungus
Molecular methods to determine the genetic diversity within the species of
List of
Species | No. of base pairs | Source/host | Country | Genbank accession no. |
---|---|---|---|---|
Endophytic isolates | ||||
|
510 bp |
|
India | KC914432* |
|
594 bp |
|
India | GU056168 |
|
528 bp |
|
India | FJ158124.1 |
|
497 bp |
|
India | EF591767.1 |
|
517 bp |
|
China | EF488410.1 |
|
510 bp |
|
China | EF488411.1 |
|
543 bp |
|
Brazil | FJ605247.1 |
|
543 bp |
|
Brazil | FJ605244.1 |
|
515 bp |
|
South Korea | AY555719.1 |
|
493 bp |
|
China | FJ449900.1 |
|
549 bp |
|
China | EU888922 |
|
561 bp |
|
Italy |
KC196121 |
|
527 bp |
|
Brazil | JQ754006 |
|
545 bp |
|
China | JF776163 |
|
515 bp | — | — | HQ682196 |
|
548 bp |
|
Korea | KF313101.1 |
|
555 bp |
|
Hungary |
JN859433 |
|
581 bp |
|
China | HM346538.1 |
|
541 bp |
|
China |
DQ166550 |
|
564 bp |
|
Kenya |
HQ651161 |
|
543 bp |
|
Thailand |
GQ862347 |
| ||||
Pathogenic Isolates | ||||
|
487 bp | Bean |
Mexico | FJ619940 |
|
569 bp | Banana | India | DQ889176.1 |
|
544 bp | Hybrid |
China | EU285554.1 |
|
544 bp |
|
China | EU862240 |
|
515 bp |
|
Mexico | AY728210 |
|
545 bp |
|
Mexico | EU161243 |
|
545 bp | Watermelon | China | EU588397 |
|
543 bp | Lily | Taiwan | AY684919 |
|
542 bp | Tulip | Mexico | DQ979010 |
|
545 bp | Cotton | China | EU849584 |
|
543 bp |
|
China | JX885462 |
|
564 bp |
|
China | JN232190 |
|
567 bp | — | China | GU136492 |
|
567 bp | — | China | GU136493 |
|
527 bp |
|
Sweden | HM036595 |
|
564 bp |
|
— | HQ651161 |
|
552 bp | — | UK | AY147369 |
|
570 bp |
|
China | EU326215 |
|
571 bp |
|
China | EU326216 |
|
546 bp | Roots of willows | — | GU934524 |
Tree showing phylogenetic relationship of 40
The evolutionary relationship of 40 taxa revealed consistency index (0.229865), retention index (0.534473), and composite index (0.122857), respectively, with a tree length of 6295. Clade I showed two clusters with an endophytic
Based on the phylogenetic analysis we hypothesize that endophytic strains have given rise to pathogenic forms. This hypothesis is supported by the fact that there is a great deal of genetic relatedness between pathogenic and nonpathogenic
However, this is perhaps the first report on endophytic fungal diversity of the endangered medicinal plant
The authors are thankful to Manipal Life Science Centre for providing the facilities for identification of endophytic fungus. And they are grateful to retired Professor G. K. Bhat, Poornaprajna College Mangalore, for helping them in finding and authenticating the plant.