The objective of this work was to validate the antibody-conjugated fluorescent dye-doped silica nanoparticle- (FDS-NP-) based assay for the rapid detection of
The detection and identification of the microorganisms are of great importance for poultry production to allow implementing proper and timely interventions that can ensure safety of the products. Traditional microbiological methods of detecting and enumerating bacteria usually require several days to yield reliable results. In many cases, the products have already been used by the consumers before the analyses are completed. Therefore, alternative rapid assays based on different microbiological methods are constantly developed [
The current development of nanotechnology has affected a variety of sciences including microbiology. The research findings have changed traditional methods into nanoscale that can be combined with different techniques to develop detection methods. Combining sol-gel and microemulsion techniques, Santra et al. [
Our research group had developed silica and ferromagnetic nanoparticle-based detection for
(a) Schematic illustration of the detection of
Alternative microbiological test methods require proper validation as guided by ISO 16140:2003 [
Therefore, the objective of this work was to validate test kit based on fluorescent dye-doped antibody-conjugated silica nanoparticles (FDS-NPs) for the rapid detection of
All chicken samples: carcass rinse water (
The standard method for culturing
For PCR amplification, the 16S
List of 16S
Target genes | Primer names | Sequences (5 |
Lengths (bp) | References |
---|---|---|---|---|
16S |
C412F | GGATGACACTTTTCGGAGC | 816 | [ |
C1228R | CATTGTAGCACGTGTGTC | [ | ||
CJF | ACTTCTTTATTGCTTGCTGC | 323 | [ | |
CJR | GCCACAACAAGTAAAGAAGC |
Note: 16S
Synthesis of FDS-NPs and surface modifications were carried out as previously described [
For surface modifications, the FDS-NPs (32 mg) were added in 1 mM of acetic acid containing 10% of trimethoxysilylpropyl diethylenetriamine (DETA) and stirred for 30 min to produce the amine functional group. Then, the carboxyl functional group was generated by adding 20 ml of N,N-dimethylformamide containing 10% of succinic anhydride and stirred for 6 h under nitrogen gas. Transmission electron microscopy (TEM) from Hitachi High Tech (model 7700, Japan) and Fourier-transform (FT) Raman spectroscopy from Bruker (model Vertex70 + RamII, Singapore) were used to determine the shape and size of FDS-NPs and the functional groups on the nanoparticle’s surfaces, respectively. All chemicals and reagents used were from Sigma-Aldrich (USA).
Following chemical modifications, the surfaces of FDS-NPs were further cross-linked with 1-ethyl-3-(3-dimethyl aminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxy succinimide (NHS) system, followed by glutaraldehyde cross-linking and bioconjugation with specific monoclonal antibody (0.1 mg/ml, ab33023; Abcam, UK) towards
Aliquots of 0.1 ml bacterial culture were incubated with 20
According to ISO 16140:2003 [
The LOD was tested with pure culture of
The inclusivity tests were conducted with pure cultures of 50 strains including
According to EN ISO 16140 standard, a minimum of 60 products from 3 product types under the poultry category must be analyzed with approximately 50% positive and 50% negative products. The reference method was modified ISO 10272-1:2017 “Microbiology of the Food Chain—Horizontal Method for Detection and Enumeration of
The principle of this method was to use FDS-NPs to attach on target cell surface. The loose particles were washed out, and the remaining aliquot was observed under fluorescent microscope for rapid detection of target cells of
FDS-NPs were prepared using water-in-oil microemulsion-based techniques. The FDS-NPs had spherical shape and sizes of approximately 50 nm in diameter, as revealed by TEM image (Figure
A TEM image of FDS-NPs. The synthesized FDS-NPs were spherical with average sizes of approximately 50 nm. Scale bar indicates 200 nm.
The surfaces of FDS-NPs were successfully modified with amine and carboxyl groups. The modification allowed the particles to attach to glutaraldehyde cross-link that could connect to monoclonal antibodies against
FT-Raman spectra of FDS-NPs with amine and carboxyl surface modifications. The spectra at 3216 and 1639 cm−1 indicate the existence of amine and carboxyl functional groups on the particles.
FDS-NPs were validated against standard mCCDA plating method (ISO 10272:2006) with multiplex PCR confirmation following ISO 16140:2003. Relative detection level, selectivity (inclusivity/exclusivity tests), and comparative studies for relative accuracy, specificity, and sensitivity were tested.
Figure
Relative LOD of serially diluted pure culture of
Please see Supplementary Materials (available
The alternative FDS-NPs method was tested against 50 strains of
Please see Supplementary Materials for information on Section
The tests provided results for calculation of relative AC, SP, SE, PPV, and NPV values. The Samples of 3 types from poultry category, 50 carcass rinse samples, 60 rectal swabs, and 30 viscera contents, were analyzed in parallel with reference and alternative methods. Sample types represented low, medium, and high naturally contaminated levels. The values were calculated by comparing with results from the reference method, mCCDA plating with duplex PCR confirmation (Figure
Gel patterns of PCR products for confirmation of
Calculations of AC, SP, SE, PPV, and NPV values of the proposed assay for detection of
Analyzed samples | PA | PD | ND | NA | Total | AC (%) | SP (%) | SE (%) | PPV (%) | NPV (%) | ||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Carcass rinses | 26 | 0 | 4 | 20 | 30 | 20 | 50 | 92.00 | 100 | 86.67 | 100 | 83.33 |
Rectal swabs | 58 | 0 | 1 | 1 | 59 | 1 | 60 | 98.33 | 100 | 98.30 | 100 | 50.00 |
Viscera contents | 27 | 0 | 1 | 2 | 28 | 2 | 30 | 96.67 | 100 | 96.42 | 100 | 66.67 |
Note: PA: positive accordance; PD: positive deviations; NA: negative accordance; ND: negative deviations;
Figure
FDS-NPs exhibited high efficiency for samples with medium to high contamination levels (Table
This observation was supported by high values of PPV at 100% for all sample types tested. PPV values were calculated from
There were 4 negative deviations with carcass samples, 1 with rectal swab and 1 with viscera content samples. The deviation affected the SE values of the test. The NPV values that indicated false negative outcomes were calculated from
The comparison was made with all sample types, 140 samples, of the poultry category, and results were tabulated in Table
Comparison of the proposed FDS-NPs assay for detection of
Reference method | |||
---|---|---|---|
Positive (+) | Negative (−) | ||
Antibody-conjugated FDS-NP assay | Positive (+) | TP 111 | FP 0 |
Negative (−) | FN 6 | TN 23 | |
Total | 117 | 23 |
Table
The values of AC, SP, SE, PPV, NPV, and kappa coefficient of the FDS-NP assay for detection of
Target bacterium | PA | PD | NA | ND | Total | AC (%) | SP (%) | SE (%) | PPV (%) | NPV (%) | |||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
111 | 0 | 23 | 6 | 117 | 23 | 140 | 95.67 | 100 | 94.87 | 100 | 79.31 | 0.86 |
FDS-NP assay is a noncultured method. The principles for detection of
The size of FDS-NPs of approximately 30–60 nm was consistent with that previously reported [
The surfaces of FDS-NPs were modified with amine and carboxyl groups. DETA and succinic anhydride were used to modify amine and carboxyl groups on the particle surface. The EDC/NHS coupling was treated on the particle surface for enhancing stability of the carboxyl group. FT-Raman spectra showed peaks at wave numbers 3400 to 3280 cm−1 that represent −NH2 asymmetric and symmetric stretching vibration. The data supported the existence of amino group from being modified by DETA. The band of 1630–1600 cm−1 indicated the C=O symmetric stretch [
Method validation is designed to confirm that an analytical procedure for a specific test is reliable, reproducible, and suitable for its intended application. These analytical methods need to be validated prior to the implementation in routine. It is especially true for this novel nanotechnology platform, where paradigm is changed from increasing target cell numbers to increasing signal of the target cells that were captured by antibody-conjugated FDS-NPs. In this single-laboratory validation, there are three tests to follow: relative detection level, selectivity (inclusivity/exclusivity tests), and comparison study, to demonstrate relative accuracy (AC), relative specificity (SP), and relative sensitivity (SE) against the reference method.
The objective of relative detection level was to determine the level of contamination to obtain 50% of positive results. To determine the LOD of the proposed assay, the FDS-NPs and reference methods were used to test various concentrations of the target
The FDS-NPs with monoclonal antibody showed high selectivity to
FDS-NPs showed high values of AC, SP, and SE to different levels of contaminations in carcass rinse, rectal swab, and viscera content samples. No false positive was observed. However, there were false negatives with rectal swab and viscera samples that could be resulting from the interference of sample matrix on attachment of the particles on cell surface. Target cells at concentrations less than 103 cfu/ml (LOD) were not detected by this method and produced not detected results (false negative).
The values of PPV and NPV demonstrated proportion of true positive and true negative results of the FDS-NP assay. High values of both numbers demonstrated high percentages of true positive and negative proportions. PPV value was calculated as the number of true positive over true positive combined with false positive results. The value of 100% indicated no false positive of this test.
Carcass rinse samples had high NPV values of 83.33% indicating low rate of false negative results. The NPV value of both rectal swabs and viscera contents was relatively low as 50% and 66.67%, respectively. However, both sample types (rectal swabs and viscera contents) had only one discrepancy each, and carcass washing samples had 4 discrepancies. This false negative observation may be due to the low number of target cells, 103cells/g. The results of mCCDA plate count with PCR assay gave positive for cells less than 103 cfu/g, but FDS-NPs displayed negative results. However, the low NPV values could be explained that it was because of too small numbers of negative samples (
With the pooled data,
The Cohen kappa values were defined by Cohen [
Compared to other findings, the 48 h real-time PCR for
The noncultured FDS-NPs with monoclonal antibody were successfully constructed with good consistency. Functional groups, amide and carboxyl, were attached onto the particle surface. Glutaraldehyde cross-linker could capture the functional group and allow antibodies to attach to the other end. That allowed FDS-NPs to readily bind on
Single-laboratory method validation of FDS-NPs against standard mCCDA plating with duplex PCR confirmation, following ISO16140:2003 guidelines, indicated that the FDS-MPs had a limit of detection level (LOD) of 103 cfu/ml. The method offered good specificity as all strains of
The limit of detection section and inclusivity and exclusivity testing data used to support the findings of this study are included within the supplementary information file.
Yortyot Seetang-Nun’s present address is Center of Excellence on Agricultural Biotechnology (AG-BIO/PERDO-CHE), Bangkok 10900, Thailand.
The authors declare that there is no conflict of interest regarding the publication of this paper.
This work was supported by funding from The Royal Golden Jubilee Ph.D. Program (RGJ) under the Thailand Research Fund (TRF) (Grant no. PHD/0024/2555).
Relative LOD: the FDS-NPs test kit (