Breast cancer is cancer with the highest incidence in Indonesia, with an incidence of 18.6 patients in 100,000 people annually [
Patients that have the same breast cancer stage and chemotherapy regiment may not have the same result. To give precise chemotherapy regimens, we need a predictive marker [
Ki-67 is a core protein which was expressed in G1, S, G2, and M phase and has been assigned as a solid tumor proliferation marker. Tumor proliferation activity shown with a Ki-67 overexpression in breast cancer is related to poor prognosis and also is predictive of neoadjuvant chemotherapy response [
Breast cancer is a heterogenic disease, based on gene expression profile or breast cancer immunohistochemistry, divided into several subtypes, that is, Luminal A, Luminal B, Her-2, and triple negative. Every subtype has a different response and aggressiveness toward systemic therapy. St. Galen consensus (2011) approved that the kind of subtype influences the breast cancer chemotherapy response [
Because of the importance of predictive marker in managing breast cancer and lack of data about Ki-67 expression in Indonesia, we are interested in evaluating the relationship of Ki-67 expression detected by IHC and qRT-PCR in breast cancer tissue prior to chemotherapy with chemotherapy response in breast cancer patients in Makassar Indonesia.
We acquired samples from breast cancer patients who received chemotherapy in Surgical Oncology Department of Wahidin Sudirohusodo Hospital, Makassar, from October 2014 until September 2015. The inclusion criteria were women with locally advanced breast cancer and invasive ductal carcinoma and women receiving cyclophosphamide-doxorubicin-5FU [
We performed clinicopathology data collection which involved age and grading. Then we performed immunohistochemistry panel examination of ER, PR, Her2, and Ki-67. We also detect Ki-67 expression using qRT-PCR. Chemotherapy response was measured clinically by using a caliper, at the moment before starting the 1st cycle of chemotherapy and three weeks after the 3rd cycle of chemotherapy. Data were collected, managed, analyzed, and presented in table and narration form, and then we compared them with the result of other studies.
Clinical response in this study is classified into two categories: nonresponsive, according to RECIST, that is, stable disease or progressive disease, which is defined as reduced tumor size < 30%, the size of the tumor remaining the same, increase of the tumor size, or discovering a new tumor; responsive, according to RECIST, that is, complete response or partial response which is defined as disappearance of tumor mass or at least the reduction of tumor size by up to 30% and no new tumors.
Immunohistochemical staining technique is employing polymer-based methods. The primary antibodies and dilutions were used (DakoCytomation, Glostrup, Denmark): ER (clone 1D5, 1 : 100), PR (clone PgR636, 1 : 100), and Ki-67 (MIB-1, 1 : 200) [
Staining intensity and percentage of positive nuclei are recorded after manually segmenting tumor from the stroma. Tumors with ER/PR Remmele scores greater than 3 or positive nuclei greater than 1% were considered hormone receptor-positive [
Extraction of nucleic acid from breast cancer tissue was performed using diatom guanidinium isothiocyanate (GuSCN) method. The sample volume of about 100 ug/ul breast cancer tissue was added to 900 mL of “L6” solution which consists of 120 g guanidinium thiocyanate (GuSCN) (Fluka Chemie AG, Buchs, Switzerland, cat number 50 990), 100 ml of 0.1 M Tris-HCl, pH 6.4, 22 ml 0.2 M ethylenediaminetetraacetate (EDTA), pH 8.0, and 2.6 g Triton X-100 (Packard, Instruments) with a final concentration of 50 mM Tris-HCl, 5 M GuSCN, 20 mM EDTA, and 0.1% Triton X-100. Then 20 mL diatom suspension was added which consists of 50 ml of H2O and 500 mL of 32% (w/v) “Celite” (“diatoms”) (Jansen Chimica, Beerse, Belgium, 10.846.79). 20 mL suspension of this diatom can bind 10 ug DNA tissue, and it is then vortexed and centrifuged in 1.5 ml Eppendorf tube with a speed of 13,000 rpm for 15 seconds. The supernatant was discarded, and the sediment was washed with “L2” solution consisting of 120 g GuSCN in 100 ml of 0.1 M Tris-HCl, pH 6.4, by adding 1 ml of “L2” solution. Furthermore, vortexing and centrifugation at 13,000 rpm for 15 seconds were performed; then wash the sediment 2 times with an “L2” solution, followed by washing with 1 ml of 70% ethanol 2 times and 1 ml acetone. The result is then heated in a water bath at a temperature of 56°C for 10 minutes. Then 60 mL solution of “TE” was added which consists of 1 mM EDTA in 10 mM Tris-HCl, pH 8.0; then vortexing is done and centrifugation is continued at a speed of 13,000 rpm for 2 minutes. Then the solution was incubated in the oven for 10 minutes at a temperature of 56°C. Then vortexing and centrifugation for 30 seconds at a speed of 13,000 rpm were conducted, and the supernatant was taken. The supernatant from this process will result in nucleotide extraction and was stored at −800°C before PCR analysis [
Detection of mRNA expression of Ki-67 was done according to Real-time PCR method previously described by Mitas, 2001, and Potemski, 2006. The process of oligonucleotide primers was specific for the gene, that is, housekeeping gene GAPDH (internal control). Detection of mRNA Ki-67 gene was performed using specific primers forward and reverse PCR protocols: Ki-67 forward: TCCTTTGGTGGGCACCTAAGACCTG and Ki-67 reverse: TGATGGTTGAGGTCGTTCCTTGATG. Cycle RT-PCR for Ki-67 was 94°C for 3 minutes; 94°C for 30 seconds, 38 cycles; and the next step is PCR: 51°C for 30 seconds. Also, specific primers of housekeeping genes used GAPDH forward: TGAGTGCTGTCTCCATGTTTGA and GAPDH reverse: TCTGCTCCCCACCTCTAAGTTG. QRT-PCR used qRT-PCR Green Master Mix Kit, one stage. This protocol was optimized for instrument MX4000. Protocol was adjusted by using the instrument by changing the dye dilution based on the instruction manual and following the recommended instrument factory for RT-PCR cycle program.
Passive reference dye was included in the reaction diluted 1 : 500. The solution containing the dye was kept away from light, diluted 2x by SYBR Green QRT-PCR Master Mix, and stayed on the ice. Following the initial melting master mix, the unused portion is stored at 40°C with the following note: avoid repeating freeze-liquid cycles. Reaction experiment was prepared by adding the following components. Make a mixture of reagents to the reaction using some components such as the following: the mixture of reagents to take a final volume of 25 mL (including experimental RNA), 12.5 mL of 2x SYBR Green QRT-PCR master mix plus × mL of early primary (optimized concentration) plus nuclease—free PCR—the rate of the primary end mL H2 × (optimized concentration), 0,375 mL reference dye solution from step 1 (optional), and 1.0 mL of RT/RNase enzyme mixture 50
Data was analyzed using SPSS (Statistical Package for Social Sciences). Samples were analyzed using
The research was done in the period from October 2014 to September 2015; subjects were breast cancer patients who met the inclusion-exclusion criteria. Of all samples collected, 48 samples were examined by immunohistochemistry method and 30 samples were tested by qRT-PCR examination. Characteristics of patients were all presented with clinical stage III A and stage III B at the time of initial diagnosis: 30 patients (62.5%) who were responsive to neoadjuvant chemotherapy and 18 patients (37.5%) who were nonresponsive. Breast cancer patient characteristics are shown in Table
Patient characteristics.
Characteristics | Number (%) |
|
---|---|---|
Age | ||
≤50 | 27 (56.3) | 0.076 |
>50 | 21 (43.8) | |
Grade | ||
Low grade | 8 (16.7) | 0.057 |
Moderate | 26 (54.2) | |
High grade | 14 (29.2) | |
Subtype | ||
Luminal A | 10 (20.8) | 0.131 |
Luminal B | 20 (41.7) | |
Her2 | 14 (29.2) | |
Triple negative | 4 (8.3) | |
Ki-67 (SD) | ||
Positive | 26 (54.2) | 0.025 |
Negative | 22 (45.8) | |
Mean of tumor size (SD) | ||
Before chemotherapy | 12.60 (0.40) | 0.031 |
After chemotherapy | 08.06 (0.20) |
The representation of microphotographs of ER, PR, HER2, and Ki67 immunostaining of this research is shown in Figure
Microphotographs of ER, PR, HER2, and Ki67 immunostaining in invasive ductal carcinoma.
Figures
Amplification curve of Ki-67 mRNA expression.
Melting peak and melting curve of Ki-67 mRNA expression.
To find out whether the Ki-67 expression has a relationship with clinical response to neoadjuvant chemotherapy in breast cancer, we used bivariate analysis, which can be seen in Table
Relation of Ki-67 expression with chemotherapy response in breast cancer.
Ki-67 expression | Chemotherapy response | Total | |
---|---|---|---|
Responsive | Nonresponsive | ||
Positive | 20 (76.9%) | 6 (23.1%) | 26 (100%) |
Negative | 10 (45.5%) | 12 (54.5%) | 22 (100%) |
|
|||
Total | 30 (62.5%) | 18 (37.5%) | 48 (100%) |
Analysis of Ki-67 expression detected by immunohistochemistry found that positive Ki-67 expression tends to be responsive to neoadjuvant chemotherapy 20 (76.9%) and negative Ki-67 expression tends to be nonresponsive to neoadjuvant chemotherapy 12 (54.5%); there were statistically significant differences with
Based on qRT-PCR examination, we found that the mean value of Ki-67 mRNA expression was
To find out whether Ki-67 mRNA expression has a relationship with clinical response to neoadjuvant chemotherapy in breast cancer, we used bivariate analysis, which can be seen in Table
Relationships between Ki-67 mRNA expression with chemotherapy response in breast cancer.
Ki-67 mRNA expression | Chemotherapy response | Total | |
---|---|---|---|
Responsive | Nonresponsive | ||
High | 16 (76.2%) | 5 (23.8%) | 21 (100%) |
Low | 1 (11.1%) | 8 (88.9%) | 9 (100%) |
|
|||
Total | 17 (56.7%) | 13 (43.3%) | 30 (100%) |
Analysis of Ki-67 mRNA expression detected by qRT-PCR found that a high level of Ki-67 mRNA expression tends to be responsive to neoadjuvant chemotherapy, 16 (76.2%), and low level of Ki-67 mRNA expression tends to be nonresponsive to neoadjuvant chemotherapy, 8 (88.9%). There were statistically significant differences with
To find out whether Ki-67 expression by immunohistochemistry has a relationship with Ki-67 mRNA expression detected by qRT-PCR, we used bivariate analysis, which can be seen in Table
Relationship between Ki-67 expression by immunohistochemistry and Ki-67 mRNA expression detected by qRT-PCR.
Ki-67 expression | Ki-67 mRNA expression | Total | |
---|---|---|---|
High | Low | ||
Positive | 15 (88.2%) | 2 (11.8%) | 17 (100%) |
Negative | 6 (46.2%) | 7 (53.8%) | 13 (100%) |
|
|||
Total | 21 (70%) | 9 (30%) | 48 (100%) |
Spearman’s
Analysis of Ki-67 expression by immunohistochemistry and qRT-PCR found that a high level of Ki-67 mRNA expression tends to have positive Ki-67 expression, 15 (88.2%), and low level of Ki-67 mRNA expression tends to have negative Ki-67 expression, 7 (53.8%). There were statistically significant differences with
Multivariate binary logistic regression analysis was used to determine independent predictors of clinical response to neoadjuvant chemotherapy in locally advanced breast cancer. Data shown in Table
Multivariate regression analysis for predictive factors.
Variable | OR | 95% CI |
|
---|---|---|---|
Age | 2.553 | 0.018–1.508 | 0.110 |
Grading | 0.063 | 0.158–4.160 | 0.802 |
Subtype | 0.528 | 0.134–2.516 | 0.468 |
Ki-67 (IHC) | 0.133 | 0.124–20.969 | 0.716 |
Ki-67 mRNA Expression | 4.385 | 1.206–286.53 | 0.036 |
From this study, we collected variable ages: the youngest was 29 years old and the oldest was 74 years old, with a median age of 46 years old, and the most populated age found was in the 4th decade, as many as 40.5%.
Globally, breast cancer patient < 50 years old is 33% of the population; meanwhile, in Asia-Pacific, it is 42%, in South-East Asia it is 47%, and, in Australia, it is 21%. SEER data in America showed breast that cancer is common in 55–64-year-old group of age, with a median age of 61 years old [
Several kinds of literature mentioned that generally the age of breast cancer patient is younger in Asia than in Europe and America. This difference possibly is caused by lifestyle factors, diet pattern, or the existence of certain gene which is related to race so that the difference in age occurred [
From the study, data obtained are as follow low grade 16.7%, moderate grade 54.2%, and high-grade 29.2%. Histopathology grading is a particular prognostic factor. Some newest studies confirm the importance of histopathology grading as a predictive and prognostic factor in breast cancer. Engstrøm et al.’s study showed in the first five years, grade 2 and 3 breast cancer had a poorer prognosis than grade 1 [
Breast cancer subtype is influencing chemotherapy response. Rouzier et al.’s study showed that a complete pathologic response rate in Basal-like subtype is as much as 45% and Her2 is as much as 45%; meanwhile luminal had a pathological complete response rate of 6% and no complete pathological response rate in normal-like subtype [
Proliferation activity has prognostic information. Measurement of proliferation activity using Ki-67 detected by IHC is still controversy [
Several studies had investigated Ki-67 prognostic significance in breast cancer. The study shows that Ki-67 overexpression correlates with disease-free survival and overall survival [
Studies revealed that Ki-67 protein expression correlates with response to chemotherapy. High Ki-67 proliferation rate was predictive of a higher probability of complete pathological response [
In our previous study, we found an insignificant correlation between expression of mRNA Ki-67 baseline with chemotherapy response. But, chemotherapy cause decrease in mRNA expression of Ki-67. The rate of Ki-67 mRNA expression has a significant correlation with clinical response to chemotherapy [
Several studies have found that changes before and after therapy in Ki-67 are a strong and independent predictor of disease-free time and survival rate [
Tumors with Ki-67 mRNA expression were examined by qRT-PCR associated with disease-free survival and overall survival of patients treated with adjuvant chemotherapy regimens. The results showed that the tumor with a high level of KI67 mRNA expression might be valuable for adjuvant therapy using docetaxel [
Studies found that high mRNA expression of Ki-67 was associated with a higher rate of the complete pathological response (36.4%) compared with low levels mRNA Ki-67 (5.8%). mRNA expression of Ki-67 is a predictor of the achievement of complete pathological response and better than Ki-67 expression which was detected by immunohistochemistry [
These results suggest that Ki-67 expression detected by both IHC and qRT-PCR is considered to be predictor of clinical response to neoadjuvant chemotherapy in locally advanced breast cancer. This result also suggests that Ki-67 mRNA expression detected by qRT-PCR and Ki-67 expression using IHC have similar results.
The authors have no conflicts of interest to declare.
The authors very gratefully thank all breast cancer patients who were willing to be a respondent in this study.