Circular RNAs (circRNAs) are a large class of endogenous noncoding RNAs that regulate gene expression and mainly function as microRNA sponges. This study aimed to explore the aberrant expression of circRNAs in colorectal cancer (CRC). Using a circRNA microarray, we identified 892 differentially expressed circRNAs between six pairs of CRC and adjacent paracancerous tissues. Among them, hsa_circ_0007142 was significantly upregulated. Further analysis in 50 CRC clinical samples revealed that hsa_circ_0007142 upregulation was associated with poor differentiation and lymphatic metastasis of CRC. Bioinformatic analysis and luciferase reporter assay showed that hsa_circ_0007142 targeted miR-103a-2-5p in CRC cells. Moreover, the silencing of hsa_circ_0007142 by siRNAs decreased the proliferation, migration, and invasion of HT-29 and HCT-116 cells. Taken together, these findings suggest that hsa_circ_0007142 is upregulated in CRC and targets miR-103a-2-5p to promote CRC.
Colorectal cancer (CRC) has the third highest incidence among cancers and is the fourth leading cause of cancer-related mortality worldwide [
Circular RNAs (circRNAs) are noncoding RNAs that play an important role in regulating gene expression and function [
The present study was approved by the Ethics Committee of Huai’an First People’s Hospital, Nanjing Medical University (Huai’an, China), and written informed consent was obtained from each patient. The tissue samples of CRC and paired adjacent paracancerous tissues were obtained from CRC patients at Huai’an First People’s Hospital. All patients did not receive prior radiotherapy and chemotherapy, and CRC was confirmed by experienced pathologists. After surgery, the tissues were quickly snap-frozen and stored at -80°C until further analysis.
Human colorectal cancer HCT-116, HT-29, and LoVo cells and normal human enteral epithelial (HCO) cells were obtained from the Shanghai Institutes for Biological Sciences (Shanghai, China) and cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Hyclone, Logan, UT, USA) supplemented with 10% FBS, 100 units/mL of penicillin, and 100 mg/mL of streptomycin at 37°C in an incubator with 5% CO2.
Total RNA was isolated from CRC tissues and cells using TRIzol reagent as described previously [
The sequences for primers and siRNAs.
Primers used for qRT-PCR | ||
GAPDH F | GGGAGCCAAAAGGGTCAT | |
GAPDH R | GAGTCCTTCCACGATACCAA | |
hsa_circ_0007142 F | GAACTCTGCCTCAGGATGAA | |
hsa_circ_0007142 R | AACGTGTAACCTCGGTACCA | |
U6 | F | CTCGCTTCGGCAGCACA |
U6 | R | AACGCTTCACGAATTTGCGT |
U6 | RT | GTCGTATCCAGTGCAGGGTCCGAGGTAT |
TCGCACTGGATACGACCAAATATGGAAC | ||
miR-103a-2-5p | F | GCGCGAGCTTCTTTACAGTGCT |
miR-103a-2-5p | R | ATCCAGTGCAGGGTCCGAGG |
miR-103a-2-5p | RT | GTCGTATCCAGTGCAGGGTCCGA |
GGTATTCGCACTGGATACGACCA AGGC | ||
siRNAs oligonucleotides | ||
si-circ_0007142 | GGAAACAGCTTTTTATAAC |
The control and si-hsa_circ_0007142 siRNAs (mixtures of three siRNAs targeting different sites of hsa_circ_0007142) were designed and synthesized by RiboBio (Guangzhou, China; Table
The Cell Counting Kit-8 (CCK-8, Dojindo, Japan) assay was performed to evaluate CRC cell proliferation. Briefly, 48 h after transfection, cells were seeded in 96-well plates at a density of 5×103/well, and cell viability was measured on 1, 2, 3, and 4 days. CCK-8 reagent was added into each well and maintained at 37°C for 2 h. The OD value at 450 nm was measured using a microplate reader (Bio-Rad, Hercules, CA, USA).
Transfected cells were seeded into 6-well plates and cultured for 15 days. Then the cells were fixed with methanol and stained with 0.5% crystal violet (Beyotime Biotechnology) for 30 min. Colonies with more than 10 cells were counted under a light microscope.
A 24-well Transwell insert with 8
The plasmids carrying the fragment of either the wild-type or the mutant hsa_circ_0007142 sequence of the predicted miR-103a-2-5p binding sites were constructed by Geneseed (Guangzhou, China). HT-29 cells were cotransfected with the plasmids and miR-103a-2-5p mimic using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). After 48 h, cells were collected and luciferase activity was determined using the Dual Luciferase Reporter Assay System (Promega, Madison, WI, USA).
All data were presented as mean ± standard deviation (SD) and analyzed using SPSS 20.0 software (IBM, USA). Differences between groups were analyzed using Student’s
To assess the expression of circRNAs in CRC, the differential expression of circRNAs between six CRC tissues and six paracancerous tissues was examined by circRNA microarray. A total of 892 differentially expressed circRNAs were found in CRC, including 412 upregulated and 480 downregulated (fold >2,
The top ten upregulated and downregulated circRNAs in CRC ranked by fold changes in microarray data.
CircRNA ID | CircRNA type | Chrom | Gene symbol | Fold change | Regulation | P value |
---|---|---|---|---|---|---|
hsa_circ_0000072 | exonic | chr1 | OMA1 | 43.4572991 | up | 0.005985797 |
hsa_circ_0007142 | exonic | chr10 | DOCK1 | 34.9353568 | up | 2.71168E-05 |
hsa_circ_0008812 | exonic | chr9 | RAD23B | 32.0813361 | up | 0.00009244 |
hsa_circ_0050514 | exonic | chr19 | UBA2 | 27.7446201 | up | 2.68425E-05 |
hsa_circ_0085923 | exonic | chr8 | PLEC | 23.5020249 | up | 0.004162563 |
hsa_circ_0087855 | exonic | chr9 | RAD23B | 23.161069 | up | 0.000133271 |
hsa_circ_0005954 | exonic | chr6 | AMD1 | 22.1403464 | up | 0.00069505 |
hsa_circ_0005050 | exonic | chr2 | XPO1 | 22.0953662 | up | 0.000244329 |
hsa_circ_0005281 | exonic | chr17 | TBCD | 21.7534364 | up | 1.32686E-06 |
hsa_circ_0000994 | exonic | chr2 | SLC8A1 | 21.3375077 | up | 0.000346993 |
hsa_circ_0072279 | exonic | chr5 | NUP1 | 13.3423298 | down | 0.000659178 |
hsa_circ_0001704 | intragenic | chr7 | - | 12.7785132 | down | 0.000891495 |
hsa_circ_0035626 | exonic | chr15 | RPS27L | 11.6798313 | down | 0.029341895 |
hsa_circ_0001525 | intronic | chr5 | - | 10.49926 | down | 0.000123931 |
hsa_circ_0005904 | exonic | chr2 | DCAF17 | 10.3297308 | down | 1.74038E-06 |
hsa_circ_0008367 | exonic | chr9 | IARS | 10.183079 | down | 0.00136856 |
hsa_circ_0047303 | exonic | chr18 | ZNF521 | 9.2977975 | down | 0.006717343 |
hsa_circ_0087565 | exonic | chr9 | ZNF169 | 8.7255455 | down | 0.018358601 |
hsa_circ_0000488 | intronic | chr13 | - | 8.4844294 | down | 0.000260793 |
hsa_circ_0031569 | exonic | chr14 | HEATR5A | 8.432469 | down | 0.00854826 |
CircRNA ID: The circRNA ID can be found in circBase (
circRNAs generated from. “-” indicates that circRNA microarray did not provide the gene symbol of circRNA derived from intragenic or intronic types.
Fold Change: calculated from the ratio of the two groups (normal tissues versus CRC tissues). P-value: computed from paired t-test.
Five target miRNAs of differentially expressed circRNAs in microarray data.
CircRNA ID | Regulation | MRE |
---|---|---|
hsa_circ_0000072 | up | hsa-miR-136-5p, hsa-miR-606, hsa-miR-145-5p, hsa-miR-153-5p, hsa-miR-302d-5p |
hsa_circ_0007142 | up | hsa-miR-651-3p,hsa-miR-103a-2-5p,hsa-miR-744-3p,hsa-miR-96-3p,hsa-miR-128-3p |
hsa_circ_0008812 | up | hsa-miR-138-5p,hsa-miR-325,hsa-miR-593-3p,hsa-miR-512-3p,hsa-miR-766-5p |
hsa_circ_0050514 | up | hsa-miR-433-3p,hsa-miR-215-3p,hsa-miR-34b-5p,hsa-miR-23b-3p,hsa-miR-891a-5p |
hsa_circ_0085923 | up | hsa-miR-580-5p,hsa-miR-198,hsa-miR-656-5p,hsa-miR-219a-5p,hsa-miR-758-5p |
hsa_circ_0087855 | up | hsa-miR-138-5p,hsa-miR-325,hsa-miR-593-3p,hsa-miR-512-3p,hsa-miR-766-5p |
hsa_circ_0005954 | up | hsa-miR-520f-3p,hsa-miR-618,hsa-miR-223-3p,hsa-miR-875-3p,hsa-miR-495-3p |
hsa_circ_0005050 | up | hsa-miR-452-5p,hsa-miR-146b-5p,hsa-miR-146a-5p,hsa-miR-597-3p,hsa-miR-578 |
hsa_circ_0005281 | up | hsa-miR-576-3p,hsa-miR-646,hsa-miR-219a-2-3p,hsa-miR-181b-2-3p,hsa-miR-181b-3p |
hsa_circ_0000994 | up | hsa-miR-27b-3p,hsa-miR-27a-3p,hsa-miR-373-5p,hsa-miR-335-3p,hsa-miR-628-5p |
hsa_circ_0072279 | down | hsa-miR-665,hsa-miR-874-5p,hsa-miR-188-3p,hsa-miR-29b-2-5p,hsa-miR-1271-3p |
hsa_circ_0001704 | down | hsa-miR-20b-3p,hsa-miR-641,hsa-miR-766-3p,hsa-miR-661,hsa-miR-625-5p |
hsa_circ_0035626 | down | hsa-miR-619-3p,hsa-miR-653-5p,hsa-miR-660-3p,hsa-miR-548d-5p,hsa-miR-200a-3p |
hsa_circ_0001525 | down | hsa-let-7i-5p,hsa-let-7g-5p,hsa-miR-619-5p,hsa-let-7f-5p,hsa-miR-98-5p |
hsa_circ_0005904 | down | hsa-let-7g-5p,hsa-let-7i-5p,hsa-miR-98-5p,hsa-miR-141-3p,hsa-miR-545-3p |
hsa_circ_0008367 | down | hsa-miR-330-5p,hsa-miR-216a-3p,hsa-miR-342-5p,hsa-miR-891a-3p,hsa-miR-326 |
hsa_circ_0047303 | down | hsa-miR-149-3p,hsa-miR-17-3p,hsa-miR-1301-3p,hsa-miR-509-5p,hsa-miR-516b-5p |
hsa_circ_0087565 | down | hsa-miR-766-3p,hsa-miR-612,hsa-miR-338-3p,hsa-let-7g-3p,hsa-let-7a-2-3p |
hsa_circ_0000488 | down | hsa-miR-519a-3p,hsa-miR-519b-3p,hsa-miR-28-5p,hsa-miR-130b-3p,hsa-miR-708-5p |
hsa_circ_0031569 | down | hsa-miR-128-3p,hsa-miR-30c-2-3p,hsa-miR-216a-3p,hsa-miR-585-5p,hsa-miR-140-3p |
MRE: miRNA response element.
Comparison of circRNA expression profiles between CRC and paired pericancerous tissues. (a) Scatter plots for assessing the difference in the expression of circRNAs among samples (T for CRC and B for adjacent tissues). The values of each group were plotted on the X and Y axes (
In order to validate the upregulation of hsa_circ_0007142 in CRC, we examined hsa_circ_0007142 expression level by RT-qPCR in 50 clinical CRC specimens and pericancerous tissues. Compared to adjacent noncancerous tissues, CRC tissues had a significantly higher hsa_circ_0007142 expression (
Correlation between hsa_circ_0007142 expression and clinicopathological characteristics of CRC.
Clinical Parameter | Hsa_circ_0007142 ( | Chi-squared test | |
---|---|---|---|
High group | Low group | P value | |
(≥1, n=33) | (<1, n=17) | ||
Gender | 0.623 | ||
Male | 21 | 12 | |
Female | 12 | 5 | |
Age (years) | 0.209 | ||
≤50 | 6 | 7 | |
50–70 | 15 | 6 | |
> 70 | 12 | 4 | |
Tumor size | 0.577 | ||
≤3 cm | 8 | 5 | |
3–5 cm | 17 | 10 | |
>5 cm | 8 | 2 | |
Differentiation | 0.008 | ||
Poor | 2 | 6 | |
Moderate | 24 | 11 | |
Well | 7 | 0 | |
Lymphatic metastasis | 0.037 | ||
Nx&N0 | 13 | 12 | |
N1&N2 | 20 | 5 | |
Tumor stage | 0.136 | ||
I–II | 19 | 6 | |
III–IV | 14 | 11 | |
Distant metastasis | 0.11 | ||
No | 33 | 15 | |
Yes | 0 | 2 |
ΔΔCT is the difference between the ΔCT of CRC tissues and the ΔCT of adjacent normal tissues.
hsa_circ_0007142 expression is elevated in CRC tissues and cells. (a) hsa_circ_0007142 expression in CRC tissues (
To explore the role of hsa_circ_0007142 in CRC, first we compared its expression level in CRC cell lines HCT-116, HT-29, and LoVo with normal enteral epithelial cell line HCO. The expression of hsa_circ_0007142 was significantly higher in HCT-116 and HT-29 cells than in HCO cells, but there was no significant difference between HCO and LoVo cells (Figure
hsa_circ_0007142 knockdown inhibited CRC cell proliferation. (a) CCK8 assay of the viability of HT-29 and HCT116 cells transfected with circ_0007142 (si-circ_0007142) or control siRNA (si-NC). (b) Colony-forming assay of HT-29 and HCT-116 cells transfected with si-circ_0007142 or si-NC. Data were presented as the mean ± SD of three independent experiments.
Since hsa_circ_0007142 upregulation was associated with lymphatic metastasis of CRC, next we investigated the role of hsa_circ_0007142 in the migration and invasion of CRC cells. Chamber assay showed that, compared to control siRNA groups, the knockdown of hsa_circ_0007142 by siRNA effectively decreased the invasion (Figure
hsa_circ_0007142 knockdown inhibited CRC cell migration and invasion. Transwell assays on the migration (a) and invasion (b) of HT-29 and HCT-116 cells transfected with si-circ_0007142 or si-NC.
Arraystar software revealed that hsa_circ_0007142 might target miR-103a-2-5p (Figure
MiR-103a-2-5p is a target of hsa_circ_0007142. (a) The binding site of miR-103a-2-5p for hsa_circ_0007142 was predicted by circRNA microarray. (b) miR-103a-2-5p expression was determined by RT-qPCR in HT-29 and HCT-116 cells transfected with si-circ_0007142 or si-NC. (c) PCR analysis of hsa_circ_0007142 and miR-103a-2-5p expression in CRC tissues (
As endogenous noncoding RNAs, circRNAs exhibit a remarkable organization- and disease-specific characteristic, suggesting that circRNAs may serve as specific biomarkers for disease diagnosis and therapy [
In present study, we performed circRNA microarray analysis and identified 892 differentially expressed circRNAs in CRC tissues versus paracancerous tissues. We focused on a distinctly upregulated circRNA hsa_circ_0007142, which was confirmed to be upregulated in CRC tissues and cells. The silencing of hsa_circ_0007142 by siRNAs decreased the proliferation, migration, and invasion of CRC cells. Importantly, hsa_circ_0007142 upregulation was correlated to the differentiation and lymphatic metastasis of CRC. These findings suggest that hsa_circ_0007142 might play an oncogenic role in CRC.
Furthermore, bioinformatics predicted that miR-103a-2-5p was a target of hsa_circ_0007142. While several studies suggested oncogenic role of miR-103a in CRC [
In summary, the expression of hsa_circ_0007142 is upregulated in CRC tissues and is associated with the differentiation and lymphatic metastasis of CRC. Furthermore, hsa_circ_0007142 promotes the proliferation and invasion of CRC probably by functioning as a sponge for miR-103a-2-5p. These findings may provide new clue for the strategies in the diagnosis and therapy of CRC.
All data are available upon request.
The authors declare no conflicts of interest.
Chang-li Zhu, Xiaofeng Sha, and Yuan Wang are co-first authors.
This work was supported by grants from the Project Fund of Health Bureau of Jiangsu Province (H201358) and the Project Fund of Sci & Tech Bureau of Huai’an City (HAS2015001, HAS2012003, and HAP201206).