Kinases have been implicated in the immunopathological mechanisms of Systemic Lupus Erythematosus (SLE). v-akt murine-thymoma viral-oncogene-homolog 1 (AKT1) and mitogen-activated-protein-kinase 1 (MAPK1) gene expressions in peripheral mononuclear cells from thirteen SLE patients with inactive or mild disease were evaluated using quantitative real-time reverse-transcription polymerase-chain-reaction and analyzed whether there was any correlation with T-helper (Th) transcription factors (TF) gene expression, cytokines, and S100A8/S100A9-(Calprotectin). Age- and gender-matched thirteen healthy controls were examined. AKT1 and MAPK1 expressions were upregulated in SLE patients and correlated with Th17-(Retinoic acid-related orphan receptor (ROR)-C), T-regulatory-(Treg)-(Transforming Growth Factor Beta (TGFB)-2), and Th2-(interleukin (IL)-5)-related genes. MAPK1 expression correlated with Th1-(IL-12A, T-box TF-(T-bet)), Th2-(GATA binding protein-(GATA)-3), and IL-10 expressions. IL-10 expression was increased and correlated with plasma Tumor Necrosis Factor (TNF)-
Systemic Lupus Erythematosus (SLE) is a chronic inflammatory autoimmune disease most common in women of reproductive age [
In SLE bone marrow mononuclear cells, Nakou et al. [
The imbalance in cytokine activities is associated with human autoimmune and autoinflammatory diseases, and it has been reported to play a central role in regulating SLE development [
Moreover, increased inflammation mediators S100A8/S100A9-(Calprotectin) serum and/or plasma levels have been reported in SLE patients [
The aim of this study is to assess the gene expression levels of intracellular kinases AKT1 and MAPK1 in peripheral blood mononuclear cells (PBMC) from SLE patients with inactive or mild disease and to analyze whether there was any correlation with Th-transcription factors gene expression, with gene expression and plasma levels of a comprehensive panel of cytokines (Th0-, Th1/Th17-, and Th2/Treg-type), with plasma inflammation mediators S100A8/A9-Calprotectin and clinical parameters.
The study protocol was approved by the SCUH Committee and CSIC Review Board and Ethics Committees. Written informed consent was obtained from all participating patients and controls, according to the Helsinki Declaration. Clinical data and treatments of patients are summarized (Table
Clinical parameters and treatments of SLE patients.
SLE patients | SLEDAIa | Sexb | Agec | Ld | C3e | C4e | Anti-dsDNAg | RDh | CRPi | Nj | Ddk | Treatmentl |
---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | 4 | W | 41 | 1620 | 93 | 17 | − | − | 0.11 | 4670 | 3.67 | HCQ |
2 | 0 | W | 27 | 1470 | 108 | 19 | − | − | 0.07 | 9870 | 0.75 | HCQ/PN |
3 | 0 | W | 65 | 2530 | 112 | 21 | − | − | 0.17 | 4760 | 4.5 | HCQ/PN |
4 | 0 | W | 64 | 2510 | 95 | 25 | − | − | 0.1 | 7130 | 10.5 | HCQ |
5 | 4 | W | 43 | 900 | 73 | 6 | + | − | 1.13 | 6870 | 8.67 | HCQ/PN |
6 | 2 | M | 59 | 2240 | 88 | 8 | − | − | 4.62 | 8240 | 1.08 | MTX/PN/HCQ |
7 | 0 | W | 56 | 1130 | 131 | 20 | − | − | 0.05 | 4070 | 2.58 | NT |
8 | 4 | W | 42 | 570 | 66 | 9 | + | + | 0.01 | 3120 | 8.83 | AZA/PN/HCQ |
9 | 0 | W | 40 | 750 | 62 | 12 | + | − | 1.16 | 7500 | 8.83 | MTX/HCQ/PN |
10 | 0 | W | 55 | 1740 | 110 | 15 | − | − | 0.35 | 8250 | 2.33 | MMF/PN/HCQ |
11 | 2 | M | 18 | 3420 | 129 | 11 | + | + | NDf | 12260 | 5.33 | MMF/PN/HCQ |
12 | 2 | W | 35 | 2250 | 91 | 23 | − | + | 0.08 | 6190 | 19.25 | AZA/HCQ/PN |
13 | 0 | W | 41 | 1150 | NDf | NDf | − | − | 0.7 | 3170 | 6.75 | HCQ |
| ||||||||||||
Medianm | 0 | 42 | 1620 | 94n | 16n | 0.14n | 6870 | 5.33 | ||||
(0–3) | (37.5–57.5) | (1015–2380) | (76.8 |
(9.5– 20.8) | (0.072–1.023) | (4370–8245) | (2.5–8.8) |
aSystemic Lupus Erythematosus Disease Activity index (SLEDAI).
bW: woman; M: man.
cAge (years).
dL: Lymphocytes/mL.
eComplement C3 and C4 (low <90 and/or <10, mg/dL).
fND: no determined.
gSLE patients presented anti-double stranded DNA auto antibodies (31%, three women and one man).
hRD: renal disease, (23% of SLE patients).
iCRP: C-reactive protein (mg/dL).
jN: Neutrophils/microliter.
kDd: Disease duration, at the time of the study, in years (y).
lHCQ: hydroxychloroquine; PN: prednisone; MTX: methotrexate; AZA: azathioprine; MMF: mycophenolate mofetil; NT: no treatment.
mMedian (25th to 75th percentiles).
n
Medications taken by the patients at the time the blood was drawn were recorded (Table
Blood was collected (BD Vacutainer system, K2-EDTA tubes, BD Diagnostics, Franklin Lakes, NJ, USA) and plasma and PBMC were separated using density gradient centrifugation [
Gene expression levels were measured quantitatively by qRT-PCR as previously described [
Primers for quantitative RT-PCR.
Gene1 | Accession no.1 | Description | SABiosciences Cat. no.2 |
---|---|---|---|
IL-1B | NM_000576 | Interleukin 1, beta | PPH00171B |
IFNG | NM_000619 | Interferon, gamma | PPH00380B |
IL-12A | NM_000882 | Interleukin 12A | PPH00544B |
IL-6 | NM_000600 | Interleukin 6 | PPH00560B |
TNF-alpha | NM_000594 | Tumor necrosis factor (TNF superfamily, member 2) | PPH00341E |
IL-10 | NM_000572 | Interleukin 10 | PPH00572B |
IL-2 | NM_000586 | Interleukin 2 | PPH00172B |
TGFB2 | NM_003238 | Transforming growth factor, beta 2 | PPH00524B |
IL-5 | NM_000879 | Interleukin 5 | PPH00692A |
TNFSF10 | NM_003810 | Tumor necrosis factor (ligand) superfamily, member 10 | PPH00242E |
GAPDH | NM_002046 | Glyceraldehyde-3-phosphate dehydrogenase | PPH00150E |
ACTB | NM_001101 | Actin, beta | PPH00073E |
TBX21 | NM_013351 | T-box-21 (T-bet) | PPH00396A |
GATA3 | NM_002051 | GATA-binding protein 3 | PPH02143A |
FOXP3 | NM_014009 | Forkhead box P3 | PPH00029B |
STAT4 | NM_003151 | Signal transducer and activator of transcription 4 | PPH00777E |
RORC | NM_005060 | RAR-related orphan receptor C | PPH05877A |
MAPK1 | NM_002745 | Mitogen-activated-protein-kinase 1 | PPH00715B |
AKT1 | NM_005163 | v-akt murine-thymoma viral-oncogene-homolog 1 | PPH00088A |
CD38 | NM_001775 | CD38 molecule | PPH00856A |
ZAP70 | NM_001079 | Zeta-chain (TCR) associated protein kinase 70 kDa | PPH00256A |
CD247 | NM_000734 | CD247 molecule, CD3-zeta. | PPH01484A |
CCR6 | NM_004367 | Chemokine (C-C motif) receptor 6 | PPH00616E |
| |||
Gene1,3 | Forward primer (5′–3′)4 | Reverse Primer (5′–3′)4 | Ref. |
| |||
GAPDH (NM_002046) | gaaggtgaaggtcggagtc | gaagatggtgatgggatttc | Primer3 software3 |
1
2SABiosciences, QIAGEN company.
3
4Primers used for this study based on the literature were computationally checked for sequence specificity. Melt-curve analysis for each primer pair and reaction was also tested to verified specific amplification.
Bio-Plex Precision Pro Human Cytokine 10-Plex kit assays were used to simultaneously test 10 cytokines in plasma: IL-1
Plasma concentration, a noncovalently associated Calprotection, in the presence of calcium, was measured in duplicate using a sandwich ELISA kit (no. HK325; Hycult Biotechnology, Uden, The Netherlands).
Data are given as median and 25% and 75% percentile ranges, or otherwise indicated. Relative mRNA expression levels of the genes in patients’ PBMC versus controls were evaluated using the nonparametric Wilcoxon Signed Rank test and comparing the medians against a hypothetical median (value equal 1). Determinations of significant differences between groups were compared using the non-parametric Mann-Whitney
AKT1 (7.82 (2.61–11.45)), MAPK1 (19.47 (8.71–33.45)), and ZAP70 (1.98 (1.14–3.66)) relative gene expressions levels were significantly augmented in PBMC from SLE patients (
(a) Intracellular kinases and immunoreceptors gene expressions levels. RNAs extracted from PBMC of SLE patients (
In PBMC from patients and controls, relative gene expression of T-box transcription factor (T-bet or TBX21) and signal transducer and activator of transcription (STAT)-4, both for Th1 cells; GATA3, a member of the GATA family of zinc finger proteins for Th2; retinoic acid-related orphan receptor (ROR)-C, for Th17 cells and forkhead/winged helix transcription factor (FOXP)-3 for Treg cells [
In SLE patients, gene expression ratios of both FOXP3/RORC (1.90 (1.41–4.85)) and FOXP3/GATA3 (2.17 (1.67–7.22)) were significantly increased versus controls (Wilcoxon Signed Rank test,
In SLE patients, cytokines mRNA expressions were evaluated using a RT2 Profiler PCR Array System. Results indicated that IL-10 relative gene expression was significantly increased versus controls (Table
Cytokines relative mRNA levels in PBMC.
Genesa | SLE ( |
---|---|
IL-1B | 1.36 (0.75–1.88) |
IL-2 | 1.20 (0.26–6.03) |
IL-5 | 1.41 (0.60–2.70) |
IL-6 | 1.41 (0.58–6.08) |
IL-10 |
|
IL-12A | 1.67 (0.58–2.81) |
IFN- |
1.24 (0.74–2.32) |
TNF- |
0.20 (0.16–2.20) |
TGFB2 | 1.17 (0.25–2.24) |
TNFSF10 | 1.37 (0.95–1.92) |
aRNAs extracted from PBMC of SLE patients (
bValues of the relative mRNA levels are presented as Median (25th to 75th percentile).
cIL-10 gene expression was increased in SLE patients compared with controls (Wilcoxon Signed Rank test,
Analysis of the data was done using the GraphPad Prism v.5.01 software.
Cytokines plasma levels.
Cytokinesa, b | SLE ( |
Controls ( |
|
---|---|---|---|
IL-1 |
0.24 (0.10–0.96) | 0.10 (0.10–0.13) |
|
IL-2 | 0.61 (0.60–20.24) | 0.60 (0.60–2.62) | 0.1893 |
IL-4 | 0.10 (0.10–0.68) | 0.10 (0.10–0.19) | 0.6607 |
IL-5 | 1.00 (1.00–1.00) | 0.90 (0.80–1.00) |
|
IL-6 | 1.00 (1.00–22.35) | 1.00 (0.85–1.00) |
|
IL-10 | 2.82 (0.75–9.64) | 0.63 (0.60–3.22) | 0.1368 |
IL-12(p70) | 1.02 (0.60–1.68) | 0.18 (0.06–0.50) |
|
IL-13 | 0.20 (0.20–3.87) | 0.20 (0.19–0.21) | 0.0685 |
IFN- |
0.64 (0.20–3.76) | 0.20 (0.20–0.33) |
|
TNF- |
0.34 (0.10–2.10) | 0.10 (0.10–0.30) | 0.1193 |
aA multiplex bead array (Bio-Plex, BioRad) was used to simultaneously measure 10 different cytokines in each plasma sample. Samples from patients and controls were analyzed in parallel. Values are in pg/mL. Limits of detection (pg/mL) for the indicated cytokines were: 0.1, 0.64, 0.17, 0.88, 0.29, 0.17, 0.37, 0.19, 0.35, and 0.2, respectively. Analyses of data were performed using five-parameter logistic curve fitting to standard analyte values. Intra-assay and interassay CV were ≤8% and ≤10%, respectively.
bValues are presented as Median (25th to 75th percentiles).
cMann-Whitney
Significance levels set at
In SLE (
Spearman’s rank correlations obtained between cytokines gene expressions in PBMCs and cytokines plasma levels in SLE patients.
Gene | SLE ( | ||||||
---|---|---|---|---|---|---|---|
Plasma cytokines | |||||||
IL-1 |
IL-2 | IL-6 | IL-10 | IL-12(p70) | IFN- |
TNF- |
|
IL-1B | |||||||
|
0.6082 | ||||||
|
0.0274 | ||||||
IL-6 | |||||||
|
0.6110 | 0.7427 | 0.7204 | 0.8253 | 0.6877 | 0.7856 | 0.8970 |
|
0.0265 | 0.0036 | 0.0055 | 0.0005 | 0.0094 | 0.0015 | <0.0001 |
IL-10 | |||||||
|
0.6101 | ||||||
|
0.0268 |
||||||
| |||||||
Gene | Gene | ||||||
IL-2 | IL-6 | IL-10 | IL-12A | IFN- |
TGFB2 | ||
| |||||||
IL-2 | |||||||
|
1 | 0.6538 | 0.6319 | 0.9106 | 0.7868 | ||
|
0.0153 | 0.0205 | <0.0001 | 0.0014 | |||
IL-6 | |||||||
|
1 | 0.7582 | 0.7180 | ||||
|
0.0027 | 0.0057 | |||||
IL-10 | |||||||
|
1 | 0.7813 | 0.6190 | ||||
|
0.0016 | 0.0241 | |||||
IL-12A | |||||||
|
1 | 0.6905 | 0.7796 | ||||
|
0.0090 | 0.0017 |
Significant Spearman’s rank correlations coefficients are indicated.
Significance levels set at
In SLE patients, there were significant correlations between MAPK1, AKT1, T-bet, RORC, and GATA3 relative gene expressions, respectively (Table
Spearman’s rank correlations found between MAPK1, AKT1, and Th-transcription factors gene expressions in SLE patients.
SLE ( | ||||||
---|---|---|---|---|---|---|
Gene | AKT1 | T-bet | STAT4 | GATA3 | RORC | FOXP3 |
MAPK1 | ||||||
|
0.9188 | 0.5659 | 0.5609 | 0.6154 | ||
|
<0.0001 | 0.0438 | 0.0463 | 0.0252 | ||
AKT1 | ||||||
|
1 | 0.6300 | ||||
|
0.0210 | |||||
T-bet | ||||||
|
1 | 0.7912 | 0.9231 | 0.8958 | 0.9066 | |
|
0.0013 | <0.0001 | <0.0001 | 0.0004 | ||
STAT4 | ||||||
|
1 | 0.7308 | 0.7253 | 0.5659 | ||
|
0.0045 | 0.005 | 0.0438 | |||
GATA3 | ||||||
|
1 | 0.9066 | 0.9066 | |||
|
<0.0001 | <0.0001 | ||||
RORC | ||||||
|
1 | 0.7802 | ||||
|
0.0017 |
Significant Spearman’s rank correlations coefficients are indicated.
Significance levels set at
Spearman’s rank correlations found between gene expressions of AKT1, MAPK1, FOXP3, cytokines, IL-10, and Th-transcription factors.
SLE ( | ||||||
---|---|---|---|---|---|---|
Gene | AKT1 | MAPK1 | FOXP3 | RORC | GATA3 | T-bet |
IL-2 | ||||||
|
0.7692 | |||||
|
0.0021 | |||||
IL-5 | ||||||
|
0.6970 | 0.7895 | 0.6575 | |||
|
0.0081 | 0.0013 | 0.0106 | |||
IL-6 | ||||||
|
0.6484 | |||||
|
0.0165 | |||||
IL-10 | ||||||
|
0.5549 | 0.8022 | 0.6923 | 0.7143 | 0.5604 | |
|
0.0490 | 0.0010 | 0.0087 | 0.0061 | 0.0463 | |
IL-12A | ||||||
|
0.5942 | 0.9051 | ||||
|
0.0322 | <0.0001 | ||||
IFN- |
||||||
|
0.6703 | |||||
|
0.0122 | |||||
TNFSF10 | ||||||
|
0.6556 | |||||
|
0.0150 | |||||
TGFB2 | ||||||
|
0.6584 | 0.6960 | 0.6990 | |||
|
0.0144 | 0.0082 | 0.0082 |
Significant Spearman’s rank correlations coefficients are indicated.
Significance levels set at
Spearman’s rank correlation test.
SLE ( | |||||||||
---|---|---|---|---|---|---|---|---|---|
CRPc | Nd | Age | C4c | Lf | CD38e | ZAP70e | CCR6e | ||
Cytokinesa | Genee | ||||||||
IL-1 |
IL-2 | ||||||||
|
0.5944 | |
0.6658 | ||||||
|
0.0415 | |
0.0130 | ||||||
IL-2 | IL-10 | ||||||||
|
0.6671 | |
0.6107 | 0.5915 | |||||
|
0.0178 | |
0.0266 | 0.0332 | |||||
IL-6 | IL-12A | ||||||||
|
0.6160 | |
0.6419 | ||||||
|
0.0329 | |
0.0180 | ||||||
IL-10 | TGFB2 | ||||||||
|
0.6690 | |
0.5909 | ||||||
|
0.0174 | |
0.0335 | ||||||
IL-13 | TNFSF10 | ||||||||
|
0.8629 | |
−0.5750 | ||||||
|
0.0003 | |
0.0398 | ||||||
IFN- |
TNF- |
||||||||
|
0.7261 | |
0.6740 | ||||||
|
0.0075 | |
0.0115 | ||||||
TNF- |
AKT1 | ||||||||
|
0.6834 | |
0.6061 | ||||||
|
0.0143 | |
0.0281 | ||||||
GATA-3 | |||||||||
|
0.6190 | ||||||||
|
0.0241 | ||||||||
STAT4 | |||||||||
|
0.7836 | 0.5659 | |||||||
|
0.0026 | 0.0438 | |||||||
Calprotectinb | CCR6 | ||||||||
|
0.6593 | |
0.7343 | ||||||
|
0.0142 | |
0.0065 |
aPlasma Cytokines (pg/mL).
bCalprotectin plasma levels (ng/mL).
c
dN: Neutrophils.
eGene: Gene expression, as indicated in legend of Figure
fL: Lymphocytes.
Significant Spearman’s rank correlations coefficients are indicated.
Significance levels set at
Plasma levels of inflammation mediator Calprotectin were augmented in SLE patients (175.6 (138.9–229.2) ng/mL,
In this study, we observed that AKT1 and MAPK1 gene expressions were upregulated in SLE patients with mild or inactive disease and correlate with gene expressions levels of Th17-(RORC), Treg-(TGFB2), and Th2-(IL-5)-related genes, respectively. Additionally, AKT1 gene expression also correlates with MAPK1 expression in SLE patients. PI3 K/AKT and MAPK pathways are regulated by extensive crosstalk at different levels [
Our results show that MAPK1 gene expression also correlates with gene expression levels of Th1-(IL-12A, T-bet), Th2-(GATA3), and IL-10 genes. MAPK/ERK signaling pathways integrate cytoplasmic signals to produce changes in transcription associated with differentiation, proliferation, and survival in multiple stages of T cell development [
Our data show a clear increase in FOXP3-(Treg) gene expression levels in SLE patients and positively correlate with IL-10 gene expression. Recent reports provided new data about the mechanisms linking IL-10 and Treg cells by demonstrating that IL-10 directly signals in Th17 and Treg cells to maintain control of Th17 cell-mediated inflammation [
How Treg cell function and FOXP3 expression are regulated is an important question under intensive investigation [
Balance between FOXP3 and RORC function has been postulated that determines CD4+T cell fate and the type of immune response that will be generated [
Several studies have shown a trend towards increased Th17 cells and Th17/Th1 ratio in SLE patients with active disease [
Tregs presented core suppressive mechanisms driven by FOXP3. Nevertheless they are also able to adapt in response to stimuli by homing to sites of inflammation and exerting suppressive functions. It has been reported that Treg are able to express other transcription factors normally associated with other Th cell subtypes in order to better control immunopathology (see review [
Moreover, our results show a moderate increase of ZAP70 tyrosine kinase gene expression in SLE’s PBMC and ZAP70 correlate with gene expressions levels of TNF-
Furthermore our data show that increased inflammation mediator S100A8/S100A9-Calprotectin plasma levels in SLE patients positively correlate with neutrophils numbers. S100A8/S100A9-Calprotectin is expressed by neutrophils, monocytes, activated macrophages [
Despite the fact that the study has been performed in a small number of patients, the results and the positive correlations found suggest biological functions and associations that need to be further confirmed in a larger cohort of patients.
SLE patients with inactive or mild disease presented a systemic immunoinflammatory activity with augmented AKT1 and MAPK1 gene expressions, plasma proinflammatory cytokines, and Calprotectin, together with increased gene expression of Treg-related genes, suggesting an ongoing regulatory feedback opposing the inflammatory activity.
S. Garcia-Rodriguez, J.-L. Callejas-Rubio, N. Ortego-Centeno, J. Sancho, and M. Zubiaur participated in acquisition, analysis, and interpretation of data; E. Zumaquero and P. Navarro participated in data acquisition; J.-L. Callejas-Rubio, N. Ortego-Centeno, R. Ríos-Fernandez, and S. Arias-Santiago performed clinical evaluation of patients and controls. M. Zubiaur wrote the paper revised by S. Garcia-Rodriguez, J.-L. Callejas-Rubio, N. Ortego-Centeno, R. Ríos-Fernandez, S. Arias-Santiago, and J. Sancho. Authors approved the final paper.
The authors declare no financial conflict of interests.
Thanks are due to patients, controls, and staff of Systemic Autoimmune Diseases Unit, Departments of Internal Medicine and Department of Dermatology (SCUH-Granada). This paper is supported by European Commission-European Regional Development Fund (ERDF/FEDER), in collaboration with: ISCIII-FIS06-1502 (M. Zubiaur); CSIC-PI 200820I216 (M. Zubiaur); Junta de Andalucía (JA), Consejerías Innovación-Ciencia-Empresa y Educación-Ciencia (CVI 226, CVI 908-2006 and PC08-CTS-04046) (J. Sancho and M. Zubiaur); ME-MICINN (SAF-2005-060656-C02-01 and SAF-2008-03685) (J. Sancho and M. Zubiaur) and SAF-2011- 27261 (J. Sancho); JA-FEDER-Fellowship (E. Zumaquero) and JAE-Doc-CSIC-FEDER (S. Garcia-Rodriguez).