Inflammation has emerged as a critical biological process contributing to nearly all aspects of cardiovascular disease including heart failure (HF) [
Recently, a number of studies have used gene expression, array screening, cloning, and other techniques to identify new cardiokines and cardiokine networks that are regulated during cardiac stress [
Despite significant progress in the treatment of HF, patients with advanced HF continue to present significant morbidity and mortality. As HF reaches end stage, the only viable options currently available are transplantation, mechanical circulatory support such as left ventricular assist device (LVAD), or terminal care [
Our hypothesis is that the myocardial IL-33/ST2 pathway may be involved in the hemodynamic disarrangement in end-stage HF (ESHF) patients, candidates for LVAD implantation, and may be potentially responsible for their outcome. To investigate this hypothesis, the inflammatory phenotypic profile of patients undergoing LVAD implantation will be evaluated, taking into account both the IL-33/ST2 pathway and conventional inflammatory biomarkers such as IL-6, IL-8, and TNF- to evaluate the role of inflammation in HF patients undergoing LVAD implantation (pre-LVAD group), using a group of stable HF patients undergoing heart transplantation (HT group) as control, to evaluate the effect of LVAD support on inflammation comparing the pre-LVAD group with patients at the time of LVAD weaning (post-LVAD group), to evaluate the role of inflammation in early outcomes in a pre-LVAD group of patients.
A total of twenty-two ESHF patients who underwent LVAD implantation as bridge to heart transplantation were enrolled in the study (pre-LVAD group). All patients were supported by axial continuous-flow devices (16 were HeartMateII LVADs (Thoratec, Pleasanton, CA), 4 were Incor LVADs (Berlin Heart AG), 1 was De Bakey LVADs (MicroMed Technology, Inc., Houston, TX), and 1 was HeartWare LVAD (HeartWare International Inc., Framingham, MA)). Cardiac biopsies were obtained at the moment of LVAD implantation and plasma samples were collected at preimplant and subsequently up to 1 month since LVAD implantation. Multiorgan function was monitored preoperatively and until 2 weeks after LVAD implantation, calculating the total Sequential Organ Failure Assessment (tSOFA) score. The SOFA system is a daily score from 0 to 4 assigned in proportion to the severity of functional deterioration for each six individual organ system (cardiovascular, respiratory, hepatic, renal, neurological, and hemocoagulative) [
In order to evaluate the inflammatory condition in ESHF patients and the effect of LVAD support, inflammatory mediators determined in pre-LVAD group of patients were compared with further two different groups of patients:
The study conformed the principles outlined in the Declaration of Helsinki and the study protocol was approved by local ethics committee. All subjects gave written informed consent to participate to the study.
Cardiac biopsies from the pre-LVAD group were collected at the time of LVAD implantation from the portion of LV apex excised during standard surgical procedure (needed for inflow cannula positioning). Five myocardial samples from post-LVAD and HT groups were collected at the time of transplantation from the similar areas of left (LV) and right ventricle (RV), as previously reported [
Blood samples of pre-LVAD group were obtained before and 1 month after LVAD implantation. Plasma specimens were collected in tubes with EDTA and then separated by centrifugation for 15 min at 1000 ×g. The plasma was stored at −20°C and the specific immunometric assay was performed within 2 months after collection.
Total RNA was extracted from cardiac samples by acid guanidinium thiocyanate-phenol-chloroform method using Rneasy Midi kit (Qiagen S.p.a, Milano, Italy). RNA concentration was evaluated spectrophotometrically (BioPhotometer; Eppendorf Italia, Milan, Italy) and RNA purity by electrophoresis of samples on Gel Star Stain (Lonza, Rockland Inc., ME, USA) agarose gels. RNA samples were stored at −80°C for use in gene expression studies.
Following DNAse treatment (RNase-Free DNase Set, Qiagen S.p.a), first-strand cDNA was synthesized by iScript cDNA Synthesis kit (Bio-Rad) starting from about 1
Novel inflammatory mediators, including IL-33 and ST2, and traditional molecules, such as IL-6, IL-8, and TNF-
In order to normalize the inflammatory gene expression, genes previously selected [
Analytical details of gene primers for real-time PCR analysis.
Sequence | GenBank, accession number | Length (bp) | Temp (°C) | Efficiency (%) |
| ||
---|---|---|---|---|---|---|---|
ST2 | Forward | CTCCAAGTTCATCCCCTCT | NM_000877.2 | 110 | 60 | 103.1 | 0.991 |
Reverse | GATCCAAAACCCCATTCTGTT | ||||||
IL-33 | Forward | GGAGTGCTTTGCCTTTGGTA | NM_033439 | 140 | 60 | 100.2 | 0.991 |
Reverse | TCATTTGAGGGGTGTTGAGA | ||||||
IL-8 | Forward | CCAAGCTGGCCGTGGCTTCTC | NM_000584 | 185 | 64.5 | 100.6 | 0.997 |
Reverse | TGTGTTGGCGCAGTGTGGTCC | ||||||
IL-6 | Forward | AGCGCCTTCGGTCCAGTTGC | NM_000600 | 121 | 64.5 | 100 | 0.999 |
Reverse | GTGGCTGTCTGTGTGGGGCG | ||||||
TNF- |
Forward | TCCTCAGCCTCTTCTCCTTC | NM_000594.2 | 279 | 58 | 119.8 | 0.997 |
Reverse | CCAGCTGGTTATCTCTCA | ||||||
RPL13a | Forward | CGCCCTACGACAAGAAAAAG | NM_012423 | 206 | 60 | 104.6 | 0.999 |
Reverse | CCGTAGCCTCATGAGCTGTT | ||||||
PPIA | Forward | CTTGGGCCGCGTCTCCTTCG | NM_021130 | 285 | 60 | 103.4 | 0.998 |
Reverse | TTGGGAACCGTTTGTGTTTGGGGC | ||||||
YWHAZ | Forward | ATGCAACCAACACATCCTATC | NM_00113572 | 178 | 60 | 95.3 | 0.997 |
Reverse | GCATTATTAGCGTGCTGTCTT |
Circulating levels of sST2 and IL-33 were assessed in plasma samples by specific enzyme-linked immunosorbent assays (R&D Systems, Minneapolis, MN-USA for IL-6 and IL-8). Inter-assay and intraassay CVs were <10%.
Data are expressed as median and interquartile range (I–III). Expression differences between patient groups were assessed by Mann-Whitney
The clinical characteristics of the patients are described in Table
Clinical features of ESHF patients according to sample groups.
pre-LVAD group ( |
HT group ( |
|
Post-LVAD group ( |
|
|
---|---|---|---|---|---|
Age, years | 58 (48–64) | 55 (46–62) | 0.459 | 44 (41–51) | 0.031 |
Male gender, |
19 (86) | 5 (71) | 0.569 | 6 (100) | 1.000 |
Etiology, |
0.202 | 0.673 | |||
IDC | 12 (55) | 6 (86) | 4 (67) | ||
IHD | 10 (46) | 1 (14) | 2 (33) | ||
Treatments, |
|||||
ACE-I and/or ARB | 13 (59) | 5 (71) | 0.677 | 3 (50) | 1.000 |
Beta-blockers | 16 (80) | 5 (71) | 0.633 | 4 (67) | 0.596 |
Statins | 6 (27) | 2 (29) | 1.000 | — | 0.284 |
Antiplatelet agents | 12 (54) | 2 (29) | 0.390 |
|
0.062 |
Inotropic support | 11 (50) | 1 (14) | 0.187 | 2 (33) | 0.655 |
Creatinine, mg/dL | 1.08 (0.90–1.53) | 1.32 (1.00–1.78) | 0.313 | 0.95 (0.83–1.48) | 0.599 |
t-Bil, mg/dL | 1.43 (0.55–1.90) | 0.76 (0.48–1.14) | 0.212 | 0.73 (0.31–1.34) | 0.199 |
NT-proBNP, ng/L | 2838 (1371–6042) | 2389 (840–5762) | 0.522 | 599 (158–1036) | 0.007 |
LVEF, % | 23 (19–25) | 28 (20–29) | 0.220 | 32 (20–33) | 0.104 |
LVEDV, mL | 202 (173–291) | 228 (206–300) | 0.185 | 239 (197–259) | 0.820 |
LVEDD, mm | 67 (57–71) | 70 (68–79) | 0.132 | 68 (60–75) | 0.633 |
RAP, mmHg | 5 (3–10) | 3 (2–5) | 0.074 | 5 (2–10) | 0.969 |
PCWP, mmHg | 25 (17–31) | 11 (4–20) | 0.019 | 10 (7–21) | 0.023 |
CI, L/min/m2 | 1.7 (1.4–2.2) | 2.0 (1.5–2.7) | 0.362 | 2.3 (1.9–2.8) | 0.085 |
PAPs, mmHg | 55 (42–63) | 28 (19–42) | 0.012 | 29 (21–33) | 0.006 |
Data are expressed as median (I–III interquartile range) or frequency (percentage).
ACE: angiotensin converting enzyme; ARB: angiotensin receptor blockers; CI: cardiac index; IDC: idiopathic dilated cardiomyopathy; IHD: ischemic heart disease; LVEDD: left ventricular end-diastolic diameter; LVEDV: left ventricular end-diastolic volume; LVEF: left ventricular ejection fraction; PAPs: systolic pulmonary arterial pressure; PCWP: pulmonary capillary wedge pressure; RAP: right atrial pressure; t-Bil: total bilirubin.
Median age of LVAD candidates (pre-LVAD group) was comparable to that of patients who underwent elective HT on medical therapy, without prior circulatory support (HT group). The idiopathic dilatative cardiomyopathy (IDC) was prevalent in both groups. Echocardiographic parameters as well as medical therapies did not differ between pre-LVAD and HT patients; antiplatelet and anticoagulant agents, which were mandatory in pre-LVAD patients, were prevalent in pre-LVAD group. Total bilirubin and creatinine values did not show differences between pre-LVAD group and HT group.
Among post-LVAD group, the median support time prior to heart transplantation was 367 (152–483) days. Median age of patients of post-LVAD group was lower than that of patients LVAD candidate. At heart transplantation, in patients of post-LVAD group, the levels of cardiac index, right atrial pressure, pulmonary capillary wedge pressure, and NT-proBNP were lower than those of pre-LVAD group and comparable to those of patients of HT group.
After LVAD implantation, all pre-LVAD group of patients experienced postoperative hemodynamic improvement with respect to that at preimplant (data not shown). At 3 postoperative months, 4 out of 22 (18%) pre-LVAD group of patients had died, in particular during ICU stay (second and third postoperative week), with multiorgan failure syndrome (MOFS) as main cause of death. Among survivors, the ICU length of stay was of 14 (9–23) days, while hospitalization was of 45 (30–67) days.
In all patients, the tSOFA score at 1 postoperative week was higher than that at preimplant (9 (4–10) and 4 (2–5), resp.,
The evaluation of inflammatory condition of cardiac muscle was checked in ESHF patients at the moment of LVAD implantation (pre-LVAD group) compared with a group of stable HF patients submitted to heart transplantation as control (HT group).
Cardiac expression of IL-33 and ST2, the novel inflammatory pathway, was significantly lower in pre-LVAD group than in control group (HT group) (Figures
Regulation of mediators of inflammation in cardiac tissue from ESHF patient of pre-LVAD group, HT control group, and post-LVAD group. Relative quantification of IL-33 (a), ST2 (b), IL-8 (c), TNF-
Circulating levels of inflammatory mediators were reported in Figure
Effect of 1 month LVAD support on sST2 (a) and IL-33 (b) circulating levels.
Among clinical features of pre-LVAD group, etiology of HF was identified by cardiac ST2 levels, being significantly higher in IDC than IHD patients (Figure
Relation between myocardial ST2 expression and both diagnosis ((a) and (b)) and outcome ((c) and (d)) of pre-LVAD group of samples. (a) Different ST2 expression according to HF etiology; (b) correlation with perioperative tSOFA score; (c) correlation with duration of ICU stay; (d) correlation with length of hospitalization; (e) correlation with 1 week tSOFA score; (f) ST2 expression according to composite outcome.
The effect of LVAD support on inflammatory status was evaluated at tissue level by comparison of pre-LVAD group with a group of patients at the time of LVAD weaning (post-LVAD group). Both novel and traditional inflammatory mediators were significantly higher in post-LVAD group compared with pre-LVAD group (Figure
Plasma levels of novel and traditional inflammatory mediators were measured in ESHF patients (pre-LVAD group) before and one month after LVAD implant (Figure
The clinical course of ESHF patients (pre-LVAD group) was evaluated considering the outcome indices.
Only cardiac expression of ST2, assessed at preimplant, showed a positive correlation with length of ICU, hospitalization and 1-week-tSOFA score (Figures
Accordingly, plasma levels of sST2 tended to be correlated with length of hospitalization (
No inflammatory mediators showed any differences between patients who died after LVAD implant compared with those who survived over 1 month.
Recent studies suggest that inflammation plays a role in the progression of HF [
In this study, lower tissue expression of ST2 and IL-33 was found in cardiac tissue of patients undergoing LVAD support compared to more stable patients undergoing heart transplantation on medical therapy only, indicating that their decrease could be involved in the worsening of cardiac function in these groups of ESHF patients [
The involvement of ST2/IL-33 pathway in cardiac protection is confirmed by the increase in their levels by mechanical unloading after LVAD support, which was able to restore comparable levels to those observed for the heart transplant group of patients. We might speculate that the correction of ST2/IL-33 expression could be related to the reverse remodeling process induced by mechanical unloading. This is also supported by the positive association of ST2 with the classical molecular markers of inflammation as well as with tSOFA score, a clinical indicator of systemic inflammatory condition [
In order to study the possible contribution of myocardial proteins to their circulating levels, both IL-33 and sST2 were measured in peripheral circulation. We found that baseline cardiac ST2 positively correlated with its soluble isoform and did not show any modification after 1 month of LVAD support. These data might confirm the cardiac production of soluble sST2. In agreement with these results, ST2 production was previously demonstrated in vitro from a different type of cardiac cells [
On the other hand, in experimental animal models, sST2 blocked antihypertrophic effects of IL-33, indicating that sST2 functions in the myocardium as a soluble decoy receptor [
Conversely, before LVAD implant cardiac IL-33 was negatively related with its plasma concentration that resulted significantly decreased after 1 month compared to its values before LVAD support, suggesting a different regulatory mechanism for IL-33. IL-33 appears to be a cytokine with dual function, acting both as a traditional cytokine through activation of the ST2L receptor complex and as an intracellular nuclear factor with transcriptional regulatory properties. It is able to activate cells of both the innate and adaptive immune system, to function as an alarmin alerting the immune system to necrosis, and depending on the disease can either promote the resolution of inflammation or drive disease pathology [
A further important result emerged from this study is that cardiac ST2 expression levels were significantly lower in patients with ischemic (IHD) than in patients with idiopathic dilated etiology (IDC). Previous data clearly suggest that the beneficial effects of LVAD were in part related to the etiology of the underlying HF. In fact, ESHF related to myocardial infarction has been shown to have much poorer response to LVAD therapy than nonischemic IDC [
Finally, results from this study provided further insights regarding the role of classical inflammatory mediators in HF. As with the IL-33/ST2 pathway, classical inflammatory mediators such as IL-6, IL-8, and TNF-
The relatively few studies conducted to date into the specific role of IL-33/ST2 in experimental human models limit definitive conclusions about the role that IL-33 and ST2 may play in patient outcome. However, the findings about classical inflammatory cytokines may suggest a pivotal role for these cytokines not only in regulating the inflammatory response but also in the critical balance among fibrogenesis, tissue regeneration, and cell death (apoptosis and/or necrosis). Thus, it could be possible to speculate that a fine tuning of both novel and classical inflammatory mediators, including a chemical, temporal, and spatial relationship and regulation, may occur and differentially contribute to the final outcome of LVAD patients, accounting as a major determinants of tissue remodeling.
The main limitation of this study is represented by the low number of patients. However, the internal control (HT group) and the post-LVAD group operated by collecting in the same patient myocardial tissue at HT time from both LV and RV allowed a better interpretation of the results in this limited sample size. Moreover, this low sample size made it difficult to assess the impact of different clinical variables (i.e. therapies, risk factors, etc.) on the modulation of IL33/ST2 pathway.
Our study is the first investigation in which the IL-33/ST2 pathway was studied in the in vivo setting represented by a human model of HF. Our results indicated that novel and traditional mediators of inflammation are involved in the decline of cardiac function in ESHF patients as well as in the process of reverse remodeling induced by LVAD support, supporting the value to cytokine measurements in HF patients. It remains to clarify specifically in human cardiac tissue which kind of cells were responsible for these modifications and how they were regulated at the molecular level. These data suggested that understanding inflammatory regulation in a more detailed manner is the key to achieving more effective cardiac repair and regeneration by new and more specific therapeutic strategies.
Manipulation of the IL-33/ST2 pathway represents a promising new therapeutic approach for treating or preventing various disorders in which inflammation is a critical process. To date, several approaches have been proven to modulate IL-33/ST2 signaling, addressed to its cardioprotective activity [
The authors declare that they have no conflict of interests.
This study was supported partially by grants from the projects SensorART-A Remote Controlled Sensorized ARTificial Heart Enabling Patients Empowerment and New Therapy Approaches (FP7-ICT-2009 Project, Grant Agreement 24863).