Oxidative damage has been suggested to play a role in the pathogenesis of basal cell carcinoma (BCC). This study illustrated an involvement of oxidative DNA damage and changes in antioxidant defenses in BCC by conducting a case-control study (24 controls and 24 BCC patients) and assessing urinary 7,8-dihydro-8-oxo-2′-deoxyguanosine (8-oxo-dGuo), plasma antioxidant defenses including catalase (CAT), glutathione peroxidase (GPx), NQO1, and total superoxide dismutase (SOD) activities, and glutathione (GSH) levels before surgery and 1 month after surgery. 8-oxo-dGuo expressions as well as protein and mRNA expressions of DNA repair enzyme hOGG1 and antioxidant defenses (CAT, GCLC, GPx, Nrf2, and MnSOD) in nonneoplastic epidermis of control and BCC tissues were also determined. This study observed induction in urinary 8-oxo-dGuo, increased 8-oxo-dGuo expression, and reduced hOGG1 protein and mRNA in BCC tissues, decreased activities of CAT, GPx, and NQO1, but elevated SOD activities and GSH levels in BCC patients and reduction of all antioxidant proteins and genes studied in BCC tissues. Furthermore, decreased plasma antioxidant activities in BCC patients were restored at 1 month after operation compared with preoperative levels. Herein, we concluded that BCC patients were associated with oxidative DNA damage and depletion of antioxidant defenses and surgical removal of BCC correlated with improved redox status.
Basal cell carcinoma (BCC) is the most common nonmelanoma skin cancer (NMSC) worldwide, in particular, in fair-skinned population and its incidence has been rising over the past several years [
Excessive reactive oxygen species (ROS) generated by UVR have been shown to contribute to malignant transformation of keratinocytes into cancerous cells including BCC probably through oxidative DNA damage, defects in DNA repair, and interference with cellular signaling [
This case-control study involving 48 Thai subjects (mean age, 66 years; range, 39–87 years, 22 males and 26 females) was approved by the ethics committee of the Siriraj Institutional Review Board (SIRB), Faculty of Medicine Siriraj Hospital, Mahidol University, and written informed consent was obtained by all participants. Case group comprising 24 patients newly diagnosed with BCC (mean age, 67 years; range, 41–87 years, 9 males and 15 females) and control group comprising 24 patients with nonmalignant skin diseases (mean age, 66 years; range, 39–82 years, 13 males and 11 females) were recruited from the outpatient clinic of the Department of Dermatology, Faculty of Medicine, Siriraj Hospital, from 2011 to 2014 and every diagnosis was confirmed by a pathologist. Twenty-four control subjects diagnosed with nonmalignant skin diseases were patients with dermatitis (8) (6 males and 2 females), fibroepithelial polyp (3) (3 males), melanocytic nevus (3) (3 females), normal skin (4) (4 females), and seborrheic keratosis (6) (4 males and 2 females).
Data were collected on demographics, clinical characteristics, and lifestyle as shown in Table
Demographics and clinical characteristics of controls subjects and BCC patients.
Characteristics | Control |
Cases |
|
---|---|---|---|
|
|||
Age (years) | 64.71 ± 10.58 | 66.82 ± 11.59 | 0.714 |
Gender, |
|||
Male | 13 (54.20) | 9 (37.5) | 0.247 |
Female | 11 (45.8) | 15 (62.5) | |
BMI (kg/m2) | 23.41 ± 2.38 | 22.98 ± 3.31 | 0.217 |
|
|||
Glucose (mg/dL) | 95.82 ± 12.24 | 101.65 ± 14.10 | 0.317 |
BUN (mg/dL) | 13.44 ± 3.82 | 14.32 ± 5.09 | 0.891 |
Creatinine (mg/dL) | 1.04 ± 0.23 | 1.05 ± 0.25 | 0.949 |
Cholesterol (mg/dL) | 187.97 ± 36.44 | 201.76 ± 34.21 | 0.402 |
Triglyceride (mg/dL) | 129.64 ± 62.23 | 109.76 ± 43.34 | 0.156 |
HDL-Chol (mg/dL) | 57.88 ± 18.92 | 63.59 ± 17.27 | 0.402 |
LDL-Cal (mg/dL) | 101.85 ± 31.34 | 116.22 ± 31.06 | 0.110 |
AST (U/L) | 27.24 ± 12.01 | 26.82 ± 13.50 | 0.359 |
ALT (U/L) | 20.67 ± 9.32 | 21.29 ± 12.68 | 0.593 |
eGFR (mL/min/1.73 m2) | 64.83 ± 19.44 | 65.24 ± 18.94 | 0.849 |
CBC | |||
Hemoglobin (g/dL) | 13.21 ± 1.76 | 12.84 ± 1.25 | 0.200 |
RBC count (×106/ |
4.60 ± 0.62 | 4.49 ± 0.48 | 0.404 |
WBC count (×103/ |
6.91 ± 1.65 | 7.63 ± 1.48 | 0.195 |
|
|||
Smoking, |
|||
Nonsmoker | 18 (75.0) | 19 (79.2) | 0.598 |
Ex-smoker | 5 (20.8) | 5 (20.8) | |
Current smoker | 1 (4.2) | 0 (0) | |
Drinking alcohol, |
|||
Nondrinker | 19 (79.2) | 19 (79.2) | 0.574 |
Ex-drinker | 4 (16.7) | 5 (20.8) | |
Occupation type, |
|||
Indoor | 22 (91.7) | 21 (87.5) | 0.637 |
Outdoor | 2 (8.3) | 3 (12.5) | |
Vegetarian, |
|||
Yes | 1 (4.2) | 0 (0.0) | 0.312 |
No | 23 (95.8) | 24 (100.0) | |
Chemical, |
|||
Yes | 0 (0.0) | 1 (4.2) | 0.312 |
No | 24 (100.0) | 23 (95.8) |
BMI = body mass index, BUN = blood urea nitrogen, HDL-Chol = high density lipoprotein-cholesterol, LDL-Cal = calculated low density lipoprotein cholesterol, AST = aspartate aminotransferase, ALT = alanine aminotransferase, eGFR = estimated glomerular filtration rate, CBC = complete blood count, RBC = red blood cell, and WBC = white blood cell. Data are presented as the mean ± SD. The statistical significance of differences in categorical variables data was evaluated by chi-square test (a); nonparametric variables were analyzed by the Mann-Whitney
All subjects underwent surgical intervention and the collection of blood, urine, and skin tissue samples was done on surgery day prior to operation. At 1 month after surgery, blood samples were collected for evaluation of antioxidant defense parameters and the urinary 8-oxo-dGuo levels of BCC patients were determined at both 1 and 6 months after surgery.
Blood samples were collected: 2 mL in sodium fluoride tube, 2 mL in EDTA tube, and 6 mL in lithium heparin tube for clinical chemistry assays and 10 mL in EDTA tube for antioxidant assays. Whole blood was processed according to standard protocols and centrifuged at 1,000 ×g for 10 minutes at 4°C, and the supernatants were divided into 750
20 mL of fresh urine samples was collected in urine container tube: 10 mL for clinical chemistry assays and 10 mL for oxidative DNA damage assay. Urine samples were processed according to standard protocols and centrifuged at 3,000 ×g for 10 min at 4°C, and the supernatants were collected and stored at −80°C until testing.
The skin tissue samples were obtained from lesions of BCC and nonmalignant skin diseases. All studied skin lesions in case and control patients were located on the sun-exposed areas and the size of all excised tissues was 0.5 cm in diameter. Tissue samples were divided into 2 parts; the first part was fixed in formalin solution and then embedded in paraffin block for immunohistochemistry and the second part was fixed in liquid nitrogen for RT-PCR until testing.
Urinary 8-oxo-dGuo level was quantified using a competitive enzyme immunoassay (STA-320, Cell Biolabs, San Diego, CA). Briefly, urine samples (1 : 20 dilution) or 8-oxo-dGuo standards were first added to an 8-oxo-dGuo/BSA conjugate preabsorbed enzyme immunoassay plate. After incubation, an anti-8-oxo-dGuo monoclonal antibody was added, followed by a secondary reaction with a horseradish peroxidase-conjugated antibody. 8-oxo-dGuo levels in the urine samples were then determined by comparison with the 8-oxo-dGuo standard curve. 8-oxo-dGuo levels in the urine of each subject were adjusted by urinary creatinine level and were measured as ng/mg creatinine.
Catalase (CAT) activity was determined following the kit protocol from Cayman Chemical (Ann Arbor, MI). The assay was based on the reaction of methanol and the enzyme in the presence of an optimal concentration of H2O2. The formaldehyde produced was measured colorimetrically at 540 nm using 4-amino-3-hydrazino-5-mercapto-1,2,4-triazole (Purpald) as the chromogen. CAT activity was expressed in unit/mg protein.
Glutathione peroxidase (GPx) activity assay was performed following manufacturer’s instruction (Trevigen, Gaithersburg, MD). GPx activity was coupled to glutathione reductase (GR), which catalyzed NADPH-mediated reduction of GSSG back to GSH as previously described [
NQO1 activity was evaluated spectrophotometrically as previously described [
Assay for measurement of total superoxide dismutase (SOD) activity was modified following the method of Johns et al. [
GSH assay was carried out by glutathione reductase: DTNB enzymatic recycling method following the kit protocol from Sigma-Aldrich (MO, US). Determination of GSH levels involves GSH oxidation by the sulfhydryl reagent DTNB (5,5′-dithio-bis-2-(nitrobenzoic acid)) to produce the yellow TNB (5′-thio-2-nitrobenzoic acid) measured at 412 nm. The glutathione disulfide (GSSG) formed can be recycled to GSH by glutathione reductase in the presence of NADPH. The rate of TNB production is directly proportional to this recycling reaction in turn directly proportional to the concentration of GSH. The GSH level was expressed in nmol/mg protein.
Protein concentration was measured using the Bio-Rad Protein Assay Kit (Bio-Rad, Munich, Germany) and bovine serum albumin (BSA) was used as protein standard.
Paraffin-embedded tissues were sectioned (2
IHC staining of all samples was evaluated visually and scored by a pathologist twice in different days. If the IHC staining evaluated in duplicate gave different IHC scores, visual interpretation of the IHC staining would be repeated. The semiquantitative analysis of the stained sections was carried out by light-microscopy, employing the immunoreactive score (IRS) according to the study of Kaemmerer et al. [
Improm-IITM reverse transcriptase (Promega, Madison, USA) was used to synthesize cDNA from total RNA following the manufacturer’s protocol. Sequences for PCR primer sets of genes studied were designed using the Primer Express version 3.0 software (Applied Biosystems, USA). Sequences of PCR primer (in 5′→3′ direction) were as follows: hOGG1 (product sizes = 164 bp) sense, TGGAAGAACAGGGCGGGCTA, and antisense, ATGGACATCCACGGGCACAG; CAT (product sizes = 148 bp) sense, CCTTCGACCCAAGCAACATG, and antisense, CGAGCACGGTAGGGACAGTTC; GCLC (product sizes = 160 bp), sense GCTGTCTTGCAGGGAATGTT, and antisense, ACACACCTTCCTTCCCATTG; GCLM (product sizes = 200 bp) sense, TTGGAGTTGCACAGCTGGATT, and antisense, TGGTTTTACCTGTGCCCACTG; GPx (product sizes = 94 bp) sense, ACGATGTTGCCTGGAACTTT, and antisense, TCGATGTCAATGGTCTGGAA; Nrf2 (product sizes = 161 bp) sense, TTCTGTTGCTCAGGTAGCCCCTCA, and antisense, GTTTGGCTTCTGGACTTGG; CuSOD (product sizes = 109 bp) sense, TGCTGGTTTGCGTCGTAGTC, and antisense, ACGCACACGGCCTTCGT; MnSOD (product sizes = 141 bp) sense, TGGCCAAGGGAGATGTTACAG, and antisense, CTTCCAGCAACTCCCCTTTG; GAPDH (product sizes = 150 bp) sense, CCTCCAAAATCAAGTGGGGCGATG, antisense, CGAACATGGGGGCATCAGCAGA. Real-time PCR was performed using FastStart universal SYBR Green Master with ROX (Roche diagnostic, USA) and mRNA expression was quantified by real-time PCR using ABI prism 7300 Real-Time PCR System (Applied Biosystems, USA). Melt curve analysis was performed to verify specificity of the amplified product. mRNA expression was normalized to the expression of GAPDH gene. The mean Ct of each gene in each sample was compared with the mean Ct from GAPDH determinations from the same cDNA sample in order to assess mRNA expression. Ct values were then used to calculate fold change in gene expression.
Descriptive statistics were reported as frequencies and percentage. Categorical variables were analyzed by the chi-square test and performed with SPSS 18.0 software (SPSS, Chicago, IL). Data were expressed as means ± standard deviation (SD). The results were subjected to statistical analysis using Prism 5.0 (GraphPad Software, La Jolla, CA, USA). The Shapiro-Wilk test was employed to test the normal distribution. The statistical significance between nonparametric variables was analyzed by Mann Whitney
The results shown in Table
The urinary 8-oxo-dGuo levels and all antioxidant defense parameters studied in BCC and control subjects were shown in Table
Comparison of urinary oxidative DNA damage levels and plasma antioxidant defense status between control subjects and BCC patients.
Parameters | Controls ( |
Cases ( |
|||
---|---|---|---|---|---|
Before surgery | 1 month after surgery | Before surgery | 1 month after surgery | 6 months after surgery | |
8-oxo-dGuo (ng/mg creatinine) | 61.92 ± 17.35 | 71.51 ± 16.68 | 110.08 ± 30.09 |
106.65 ± 26.17 |
64.44 ± 19.02 |
CAT (unit/mg protein) | 4.38 ± 0.80 | 3.96 ± 0.68 | 2.55 ± 0.43 |
4.34 ± 1.13 |
|
GPx (unit/mg protein) | 0.77 ± 0.20 | 0.77 ± 0.21 | 0.42 ± 0.13 |
0.75 ± 0.11 |
|
NQO1 ( |
928.25 ± 203.20 | 977.87 ± 184.54 | 708.53 ± 112.66 |
1010.30 ± 281.00 |
|
Total SOD (unit/mg protein) | 0.02 ± 0.01 | 0.02 ± 0.00 | 0.04 ± 0.01 |
0.04 ± 0.01 |
|
GSH ( |
152.19 ± 44.88 | 156.92 ± 40.41 | 235.76 ± 42.75 |
220.93 ± 52.44 |
Results were expressed as mean ± standard deviation (SD).
The urinary 8-oxo-dGuo levels (a) and plasma antioxidant defense status [CAT (b), GPx (c), NQO1 (d), and total SOD (e) activities and GSH levels (f)] in control subjects and BCC patients before and after surgery. Values given are mean ± SD. The statistical significance of differences between the control and case was evaluated by one-way ANOVA followed by Tukey’s
In control subjects, urinary 8-oxo-dGuo levels and all antioxidant defense parameters studied were not significantly different before and after surgery.
To compare systematically the DNA damage and antioxidant defense parameters among different treatment conditions, we utilized the principal component analysis. In the PCA space (Figure
The IHC staining was classified as negative, weak positive, mild positive, and strong positive and the data were presented as average IRS. H&E staining identified structures of skin sections of case and control subjects as shown in Figures
Expressions of oxidative DNA damage, DNA repair enzyme, and antioxidant proteins in skin tissues of control subjects and BCC patients by IRS.
Parameters | Controls ( |
Cases ( |
|
---|---|---|---|
Epidermis | BCC | Adjacent epidermis | |
8-oxo-dGuo | 2.30 ± 0.67 | 2.88 ± 0.30 |
2.27 ± 0.72 |
hOGG1 | 2.56 ± 0.47 | 1.77 ± 0.40 |
2.53 ± 0.47 |
CAT | 1.79 ± 0.63 | 1.18 ± 0.74 |
2.00 ± 0.48 |
GCLC | 2.17 ± 0.57 | 1.59 ± 0.56 |
2.70 ± 0.45 |
GPx | 2.02 ± 0.37 | 1.24 ± 0.51 |
1.73 ± 0.41 |
Nrf2 | 2.40 ± 0.57 | 1.53 ± 0.47 |
2.33 ± 0.44 |
MnSOD | 1.95 ± 0.53 | 1.41 ± 0.65 |
2.60 ± 0.46 |
Results were expressed as mean ± standard deviation (SD).
The H&E staining ((a)–(c)) and IHC staining for oxidative DNA damage, 8-oxo-dGuo ((d)–(g)), DNA repair enzyme, hOGG1 ((h)–(k)), and antioxidant proteins, CAT ((l)–(o)), GCLC ((p)–(s)), GPx ((t)–(w)), Nrf2 ((x)–(aa)), and MnSOD ((ab)–(ae)), in control subjects and tumor and nontumor lesions of BCC patients. Values given are mean ± SD. The statistical significance of differences between the control and case and between adjacent epidermis and tumor lesions of BCC patients was evaluated by nonparametric variables with Kruskal-Wallis test followed by Dunnett’s
In comparison of noncancerous skin lesions and normal skin of control subjects, there were no significant differences in expressions of all parameters studied (data not shown).
In agreement with protein expression data, Figure
DNA repair and antioxidant gene expression in nonmalignant skin tissues of control subjects and BCC tissues. Gene expression was evaluated by real-time PCR with the
An involvement of oxidative damage in the pathogenesis of BCC has been widely discussed since several studies have shown possible mechanisms through which excessive ROS generation and antioxidant defense impairment may play a role in malignant transformation to NMSC or keratinocytic cancer including BCC [
In addition, urinary 8-oxo-dGuo levels in control subjects in our study were observed to be higher than those of healthy subjects in previous studies employing ELISA [
We also observed decreased protein and mRNA expressions of hOGG1 in BCC tissues in comparison with epidermis of control subjects. Furthermore, the intrasubject comparison of nonneoplastic epidermis adjacent to BCC and lesional BCC skin demonstrated a higher expression of 8-oxo-dGuo and a lower expression of hOGG1 in BCC tissues compared with the adjacent epidermis. Our results are consistent with those from previous case-control studies suggesting a contribution of oxidative DNA damage and impaired hOGG1 to the development of various cancers including breast, pancreatic, gastric, and lung cancers [
A disturbance in redox homeostasis probably contributed to development of multiple tumors including NMSC which can be attributed to not only increased oxidative DNA damage but also impaired antioxidant defense capacity [
While CAT, GPx, and NQO1 activities markedly declined in BCC patients compared to control subjects, elevation of SOD activities and GSH levels was observed in association with upregulated protein expressions of GCLC, a rate-limiting enzyme in GSH synthesis, and MnSOD in the adjacent nonneoplastic tissues of BCC patients. In agreement with previous studies, lower activities of GPx and CAT as well as higher activities of SOD were observed in patients with oesophageal, gastric, and colorectal cancers compared with control subjects [
Enhancement of plasma SOD activities and GSH levels in correlation to increased protein expressions of MnSOD and GCLC in the adjacent nonneoplastic tissues of BCC patients may be due to an adaptive response of normal skin cells to persistent elevation of oxidative stress and damage in cancer patients. It has been suggested that upregulation of antioxidant defenses including GSH and MnSOD may serve as the defense mechanisms for cell survival against stress and inflammatory insults, which can take place during cancer initiation and progression [
This study showed that patients with BCC, a locally invasive malignant skin cancer, could exhibit systemic disturbance in redox status. Previous
Patients with BCC may be under oxidative stress associated with induction of oxidative DNA damage, defects in DNA repair hOGG1 at protein and mRNA levels, and reduction of plasma CAT, GPx, and NQO1 activities and of all antioxidant proteins and genes studied in the BCC tissues. Surgical removal of BCC tissues correlated with improved redox status. An elevation of plasma total SOD activities and GSH levels as well as protein expressions of MnSOD and GCLC in nonneoplastic tissues of BCC patients may indicate an adaptive response to oxidative stress. Whether oxidative DNA damage and antioxidant defense parameters can serve as biomarkers of oxidative stress to predict development and progression of BCC needs further studies.
Basal cell carcinoma
Catalase
Glutamate-cysteine ligase, catalytic subunit
Glutamate cysteine ligase, modifier subunit
Glutathione
Glutathione disulfide
Glutathione peroxidase
Hematoxylin-eosin
8-oxo-7,8-dihydro-2′-deoxyguanosine
Human 8-oxoguanine DNA N-glycosylase 1
Malondialdehyde
Nonmelanoma skin cancers
NAD(P)H dehydrogenase [quinone] 1
Nuclear factor (erythroid-derived 2)-like 2
Reactive oxygen species
Cupper superoxide dismutase
Manganese superoxide dismutase
Ultraviolet radiation.
The authors have no conflict of interests to declare.
The authors are grateful to Clinical Instructor Sasima Eimpunth, Department of Dermatology, Faculty of Medicine Siriraj Hospital, Mahidol University, for precious advice and support on subject recruitment. Negative and positive control tissues for IHC study were kindly provided by Assistant Professor Sorawuth Cho-ongsakol and Professor Ponchai O-Chareonrat, Department of Surgery, Faculty of Medicine Siriraj Hospital, Mahidol University. They are grateful to Miss Kanittar Srisook and Mrs. Ameon Amesombun, Department of Pathology, Faculty of Medicine Siriraj Hospital, Mahidol University, for IHC technique, advice, and support. They also wish to thank Ms. Phassara Klamsawat and Ms. Phonsuk Yamlexnoi for their assistance in recruiting subjects and managing the database. This research project was supported by Mahidol University, Thailand Research Fund (Grant no. RSA5580012), Faculty of Medicine Siriraj Hospital, Mahidol University, Grant no. (IO) R015532039, and the “Chalermphrakiat” Grant, Faculty of Medicine Siriraj Hospital, Mahidol University.